Transcript: Human XM_011516115.2

PREDICTED: Homo sapiens hepatocyte growth factor (HGF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HGF (3082)
Length:
5477
CDS:
191..2362

Additional Resources:

NCBI RefSeq record:
XM_011516115.2
NBCI Gene record:
HGF (3082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417122 TTTGTCCGAGTAGCATATTAT pLKO_005 2291 CDS 100% 15.000 21.000 N HGF n/a
2 TRCN0000434210 TCGAGGTCTCATGGATCATAC pLKO_005 832 CDS 100% 10.800 15.120 N HGF n/a
3 TRCN0000003308 GCAAAGACTACCCTAATCAAA pLKO.1 326 CDS 100% 5.625 7.875 N HGF n/a
4 TRCN0000047137 GCAAAGACTACCCTAATCAAA pLKO.1 326 CDS 100% 5.625 7.875 N HGF n/a
5 TRCN0000003309 GCAAGTAAGCTGAATGAGAAT pLKO.1 1469 CDS 100% 4.950 6.930 N HGF n/a
6 TRCN0000047134 GCAAGTAAGCTGAATGAGAAT pLKO.1 1469 CDS 100% 4.950 6.930 N HGF n/a
7 TRCN0000430490 GTGATACCACACCTACAATAG pLKO_005 1587 CDS 100% 10.800 8.640 N HGF n/a
8 TRCN0000336190 TTGGGATTATTGCCCTATTTC pLKO_005 1555 CDS 100% 13.200 9.240 N Hgf n/a
9 TRCN0000003310 TGTCTGAAGCACCCACCAATA pLKO.1 2375 3UTR 100% 10.800 7.560 N HGF n/a
10 TRCN0000047136 TGTCTGAAGCACCCACCAATA pLKO.1 2375 3UTR 100% 10.800 7.560 N HGF n/a
11 TRCN0000003307 CAGACCAATGTGCTAATAGAT pLKO.1 390 CDS 100% 5.625 3.938 N HGF n/a
12 TRCN0000047135 CAGACCAATGTGCTAATAGAT pLKO.1 390 CDS 100% 5.625 3.938 N HGF n/a
13 TRCN0000031282 CCCTGGTGTTTCACAAGCAAT pLKO.1 734 CDS 100% 4.950 3.465 N Hgf n/a
14 TRCN0000003306 CCCGTAATATCTTGTGCCAAA pLKO.1 1622 CDS 100% 4.050 2.835 N HGF n/a
15 TRCN0000047133 CCCGTAATATCTTGTGCCAAA pLKO.1 1622 CDS 100% 4.050 2.835 N HGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476979 GGAATTTGTCACGGTGGCAGCATC pLX_317 19.7% 99% 98.7% V5 (many diffs) n/a
2 ccsbBroadEn_15441 pDONR223 0% 39.3% 39.1% None 851_852delCTinsA;857_2169del n/a
3 ccsbBroad304_15441 pLX_304 0% 39.3% 39.1% V5 851_852delCTinsA;857_2169del n/a
4 TRCN0000474052 ACATACCTGGAATATGGGTGGTCG pLX_317 36.5% 39.3% 39.1% V5 851_852delCTinsA;857_2169del n/a
5 ccsbBroadEn_06362 pDONR223 100% 28% 27.8% None (many diffs) n/a
6 ccsbBroad304_06362 pLX_304 0% 28% 27.8% V5 (many diffs) n/a
7 TRCN0000465581 GAGGAACTTTTGAAGCTGCAGCAA pLX_317 33.8% 28% 27.8% V5 (many diffs) n/a
Download CSV