Transcript: Human XM_011517659.2

PREDICTED: Homo sapiens WASH complex subunit 1 (WASHC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WASHC1 (100287171)
Length:
1772
CDS:
16..1440

Additional Resources:

NCBI RefSeq record:
XM_011517659.2
NBCI Gene record:
WASHC1 (100287171)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130567 CGAGAACCTGTACAAGAAGTA pLKO.1 579 CDS 100% 4.950 2.970 N WASH2P n/a
2 TRCN0000245680 AGAACCTGTACAAGAAGTATG pLKO_005 581 CDS 100% 10.800 5.400 Y WASH5P n/a
3 TRCN0000245681 AGGAGAAGCTGAAGGACTTTC pLKO_005 449 CDS 100% 10.800 5.400 Y WASH5P n/a
4 TRCN0000257464 CTGGCTGGTGCTGTAACAAAG pLKO_005 616 CDS 100% 10.800 5.400 Y WASH5P n/a
5 TRCN0000168461 GTCCCAGAGAACTACTTCTAT pLKO.1 724 CDS 100% 5.625 2.813 Y WASH3P n/a
6 TRCN0000173054 CCAGGCCAAGATTGAGAAGAT pLKO.1 258 CDS 100% 4.950 2.475 Y WASH3P n/a
7 TRCN0000127606 CCCAGAGAACTACTTCTATGT pLKO.1 726 CDS 100% 4.950 2.475 Y WASH2P n/a
8 TRCN0000129470 GAAGATCAAGGGCAGCAAGAA pLKO.1 273 CDS 100% 4.950 2.475 Y WASH2P n/a
9 TRCN0000127829 GATGTCGGATCTCTTCAACAA pLKO.1 1266 CDS 100% 4.950 2.475 Y WASH2P n/a
10 TRCN0000172563 GCACTTGATGTCGGATCTCTT pLKO.1 1260 CDS 100% 4.950 2.475 Y WASH3P n/a
11 TRCN0000129376 GCAGGAATATGGCTCCATCTT pLKO.1 342 CDS 100% 4.950 2.475 Y WASH2P n/a
12 TRCN0000245679 GTTGCTCTGACATGGACACAG pLKO_005 1483 3UTR 100% 4.050 2.025 Y WASH5P n/a
13 TRCN0000127771 GAGAACTACTTCTATGTGCCA pLKO.1 730 CDS 100% 0.660 0.330 Y WASH2P n/a
14 TRCN0000172980 GCCAACGACCTCATGTACATT pLKO.1 811 CDS 100% 5.625 2.813 Y WASH5P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13628 pDONR223 100% 94.6% 83.5% None (many diffs) n/a
2 ccsbBroad304_13628 pLX_304 0% 94.6% 83.5% V5 (many diffs) n/a
3 TRCN0000468550 ACATGGAGTCAGTTCTTTTTGGCA pLX_317 30.2% 94.6% 83.5% V5 (many diffs) n/a
4 ccsbBroadEn_10420 pDONR223 100% 54.5% 53.1% None (many diffs) n/a
5 ccsbBroad304_10420 pLX_304 0% 54.5% 53.1% V5 (many diffs) n/a
6 TRCN0000475386 CCTTCTGTACATCGGAATTTACAA pLX_317 33% 54.5% 53.1% V5 (many diffs) n/a
Download CSV