Transcript: Human XM_011522504.2

PREDICTED: Homo sapiens NME/NM23 nucleoside diphosphate kinase 3 (NME3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NME3 (4832)
Length:
1061
CDS:
212..622

Additional Resources:

NCBI RefSeq record:
XM_011522504.2
NBCI Gene record:
NME3 (4832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146394 CTTCGCTAACCTCTTCCCCG pXPR_003 CGG 40 10% 1 0.2866 NME3 NME3 76569
2 BRDN0001149183 AGATTGTGCGGCGCTTCGAG pXPR_003 AGG 135 33% 2 0.181 NME3 NME3 76567
3 BRDN0001147963 GGCTCCGATGAGCGCCCGCG pXPR_003 AGG 324 79% 4 -0.8718 NME3 NME3 76568
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199229 CGGCGCACACGAACGCACCTT pLKO.1 265 CDS 100% 0.000 0.000 N NME3 n/a
2 TRCN0000037747 CGAGAGGAAGGGCTTCAAGTT pLKO.1 346 CDS 100% 4.950 3.465 N NME3 n/a
3 TRCN0000289310 CGAGAGGAAGGGCTTCAAGTT pLKO_005 346 CDS 100% 4.950 3.465 N NME3 n/a
4 TRCN0000308113 TGGGCACTGGCTGTATGAGTA pLKO_005 711 3UTR 100% 4.950 3.465 N NME3 n/a
5 TRCN0000356485 ACATCCACCTGTCTGGACGTT pLKO_005 849 3UTR 100% 2.640 1.848 N NME3 n/a
6 TRCN0000199798 GATTTCTGCATCGAGGTTGGC pLKO.1 592 CDS 100% 2.160 1.512 N NME3 n/a
7 TRCN0000037746 GCCTTGTCAAGTATATGGCCT pLKO.1 461 CDS 100% 0.660 0.462 N NME3 n/a
8 TRCN0000289235 GCCTTGTCAAGTATATGGCCT pLKO_005 461 CDS 100% 0.660 0.462 N NME3 n/a
9 TRCN0000037745 GAGGTTGGCAAGAACCTGATT pLKO.1 604 CDS 100% 0.495 0.347 N NME3 n/a
10 TRCN0000289236 GAGGTTGGCAAGAACCTGATT pLKO_005 604 CDS 100% 0.495 0.347 N NME3 n/a
11 TRCN0000199320 CGCTGGGCACTGGCTGTATGA pLKO.1 708 3UTR 100% 0.000 0.000 N NME3 n/a
12 TRCN0000037744 GCCTCTCCAATCCCTGGCGTA pLKO.1 888 3UTR 100% 0.000 0.000 N NME3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06644 pDONR223 100% 76.4% 33.3% None 177_187del;293A>T;408_409ins110 n/a
2 ccsbBroad304_06644 pLX_304 0% 76.4% 33.3% V5 177_187del;293A>T;408_409ins110 n/a
3 ccsbBroadEn_14716 pDONR223 0% 76.4% 33.3% None 177_187del;293A>T;408_409ins110 n/a
4 ccsbBroad304_14716 pLX_304 0% 76.4% 33.3% V5 177_187del;293A>T;408_409ins110 n/a
5 TRCN0000480572 GTATTGTACTGAACGTTCCGTGGC pLX_317 89.1% 76.4% 33.3% V5 177_187del;293A>T;408_409ins110 n/a
6 TRCN0000488844 TGGCATACTGATATCATATGTGTA pLX_317 63.6% 76.4% 33.3% V5 (not translated due to prior stop codon) 177_187del;293A>T;408_409ins110 n/a
Download CSV