Transcript: Human XM_011524059.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 6 (USP6), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP6 (9098)
Length:
4107
CDS:
1647..4007

Additional Resources:

NCBI RefSeq record:
XM_011524059.2
NBCI Gene record:
USP6 (9098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007337 GCGGAAGGACATACTTATGAA pLKO.1 1688 CDS 100% 5.625 7.875 N USP6 n/a
2 TRCN0000230365 GGAGCGGAAGGACATACTTAT pLKO_005 1685 CDS 100% 13.200 9.240 N USP6 n/a
3 TRCN0000011088 TGCGGAACCAATTCTTCGATA pLKO.1 2614 CDS 100% 4.950 3.465 N USP6 n/a
4 TRCN0000007336 CGTTGGAATCAACAGCAGCAT pLKO.1 1760 CDS 100% 2.640 1.848 N USP6 n/a
5 TRCN0000230366 GGGAGAATGGGAGACATATAA pLKO_005 1889 CDS 100% 15.000 7.500 Y USP6 n/a
6 TRCN0000011087 CCTCCTGAACATTCAGGAAAT pLKO.1 1982 CDS 100% 1.080 0.540 Y USP6 n/a
7 TRCN0000262629 GGTCAGTCCTCCTGAACATTG pLKO_005 1975 CDS 100% 10.800 5.400 Y TBC1D3H n/a
8 TRCN0000118541 CAAGCATCTTAGGGCCTCTAT pLKO.1 2663 CDS 100% 4.950 2.475 Y TBC1D3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10145 pDONR223 100% 60.5% 53.4% None (many diffs) n/a
2 ccsbBroad304_10145 pLX_304 0% 60.5% 53.4% V5 (many diffs) n/a
3 ccsbBroadEn_13692 pDONR223 100% 38.3% 33.2% None (many diffs) n/a
4 ccsbBroad304_13692 pLX_304 0% 38.3% 33.2% V5 (many diffs) n/a
5 TRCN0000471618 GCCCATAACCCTACGTGGCCAATT pLX_317 40.7% 38.3% 33.2% V5 (many diffs) n/a
6 ccsbBroadEn_12794 pDONR223 100% 32.1% 26% None (many diffs) n/a
7 ccsbBroad304_12794 pLX_304 0% 32.1% 26% V5 (many diffs) n/a
8 ccsbBroadEn_11333 pDONR223 100% 19.2% 19.1% None 1_6delATGGAC;155_156ins183;496_2358del n/a
9 ccsbBroad304_11333 pLX_304 0% 19.2% 19.1% V5 1_6delATGGAC;155_156ins183;496_2358del n/a
10 TRCN0000471012 TAGTACGAGTCAGATGCACTGGCC pLX_317 54.4% 19.2% 19.1% V5 1_6delATGGAC;155_156ins183;496_2358del n/a
Download CSV