Transcript: Human XM_011524793.2

PREDICTED: Homo sapiens keratin 34 (KRT34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT34 (3885)
Length:
1796
CDS:
164..1402

Additional Resources:

NCBI RefSeq record:
XM_011524793.2
NBCI Gene record:
KRT34 (3885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416812 ACACATCATCAACTTCCAATG pLKO_005 1568 3UTR 100% 6.000 3.000 Y KRT34 n/a
2 TRCN0000440933 GCTTTCCTGACCCAAGCAAAG pLKO_005 1545 3UTR 100% 6.000 3.000 Y KRT34 n/a
3 TRCN0000116828 GAGTCGGACATCAACAGCATA pLKO.1 683 CDS 100% 4.950 2.475 Y KRT34 n/a
4 TRCN0000433778 TGACGACTTCAGAAGCAAGTA pLKO_005 631 CDS 100% 4.950 2.475 Y KRT34 n/a
5 TRCN0000116827 GCTGACATCAAGAAACCTCAT pLKO.1 1491 3UTR 100% 4.050 2.025 Y KRT34 n/a
6 TRCN0000116689 CCAGTCCTACTTCAAGACCAT pLKO.1 526 CDS 100% 2.640 1.320 Y KRT33B n/a
7 TRCN0000415804 GACCCTGTGGCACCTCTCAAA pLKO_005 1365 CDS 100% 1.650 0.825 Y KRT34 n/a
8 TRCN0000116830 CCACCACCAATGCTAGTGGCA pLKO.1 1335 CDS 100% 0.220 0.110 Y KRT34 n/a
9 TRCN0000089800 AGCAGAAGATTCTGTGTGCTA pLKO.1 558 CDS 100% 2.640 1.320 Y Krt34 n/a
10 TRCN0000433521 AGACCGAGGAGCTGAACAAAG pLKO_005 966 CDS 100% 10.800 5.400 Y KRT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06510 pDONR223 100% 93% 91.2% None (many diffs) n/a
2 ccsbBroad304_06510 pLX_304 0% 93% 91.2% V5 (many diffs) n/a
3 TRCN0000477279 GGCACAGACCCCCTATCAGTTGAG pLX_317 24% 93% 91.2% V5 (many diffs) n/a
4 ccsbBroadEn_00921 pDONR223 100% 85.6% 83.8% None (many diffs) n/a
5 ccsbBroad304_00921 pLX_304 0% 85.6% 83.8% V5 (many diffs) n/a
6 ccsbBroadEn_00920 pDONR223 100% 81.9% 80.4% None (many diffs) n/a
7 ccsbBroad304_00920 pLX_304 0% 81.9% 80.4% V5 (many diffs) n/a
8 TRCN0000467714 ATTAGCGGGGACGAAACGTTTAGA pLX_317 35% 81.9% 80.4% V5 (many diffs) n/a
Download CSV