Transcript: Human XM_011527729.2

PREDICTED: Homo sapiens zinc finger protein 433 (ZNF433), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF433 (163059)
Length:
2280
CDS:
134..2152

Additional Resources:

NCBI RefSeq record:
XM_011527729.2
NBCI Gene record:
ZNF433 (163059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019856 CCTCTGTTCAGACACATGAAA pLKO.1 594 CDS 100% 5.625 4.500 N ZNF433 n/a
2 TRCN0000435258 ACATGCCTTCATGCTCATAAA pLKO_005 929 CDS 100% 13.200 9.240 N ZNF433 n/a
3 TRCN0000019857 CAGTGCTCATTCATCTCTTAA pLKO.1 469 CDS 100% 13.200 9.240 N ZNF433 n/a
4 TRCN0000414601 GTTCGAGCTCCTTTCGATATC pLKO_005 1680 CDS 100% 10.800 7.560 N ZNF433 n/a
5 TRCN0000019855 CCCAGTTCACTTCAAACACAT pLKO.1 1262 CDS 100% 4.950 3.465 N ZNF433 n/a
6 TRCN0000019858 GCCTCACTCCTTCAAACACAT pLKO.1 1430 CDS 100% 4.950 3.465 N ZNF433 n/a
7 TRCN0000019854 GCCGTATGAATGTAAGGGTTA pLKO.1 1558 CDS 100% 4.050 2.835 N ZNF433 n/a
8 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1295 CDS 100% 15.000 7.500 Y ZNF443 n/a
9 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1295 CDS 100% 15.000 7.500 Y Zfp97 n/a
10 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1800 CDS 100% 5.625 2.813 Y ZNF345 n/a
11 TRCN0000015519 CAGTTTGTATCTTATCCACAA pLKO.1 760 CDS 100% 4.050 2.025 Y ZNF625 n/a
12 TRCN0000218191 GAGAAACCTTACGAGTGTAAT pLKO_005 1385 CDS 100% 13.200 6.600 Y LOC676710 n/a
13 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1717 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13330 pDONR223 100% 94.9% 94.9% None 1_102del n/a
2 ccsbBroad304_13330 pLX_304 0% 94.9% 94.9% V5 1_102del n/a
3 TRCN0000478197 AGATGAGACAGGCCTTGCCATGGA pLX_317 12% 94.9% 94.9% V5 1_102del n/a
4 ccsbBroadEn_04522 pDONR223 100% 40.4% 34.6% None (many diffs) n/a
5 ccsbBroad304_04522 pLX_304 0% 40.4% 34.6% V5 (many diffs) n/a
6 TRCN0000473435 ATGACCCTTTTGTAACTTCACGAC pLX_317 41.5% 40.4% 34.6% V5 (many diffs) n/a
Download CSV