Transcript: Human XM_011528202.3

PREDICTED: Homo sapiens cytochrome P450 family 4 subfamily F member 12 (CYP4F12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP4F12 (66002)
Length:
1279
CDS:
86..1213

Additional Resources:

NCBI RefSeq record:
XM_011528202.3
NBCI Gene record:
CYP4F12 (66002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064284 CGATCTTCAACAAGAGTGCAA pLKO.1 132 CDS 100% 2.640 3.696 N CYP4F12 n/a
2 TRCN0000064285 CCGCAGGAAGCTGGAATTGAT pLKO.1 1132 CDS 100% 5.625 4.500 N CYP4F12 n/a
3 TRCN0000064283 GCATTGTCAGATGAGGATATA pLKO.1 572 CDS 100% 13.200 9.240 N CYP4F12 n/a
4 TRCN0000064287 GCGATCCTAAAGAGATTGAAT pLKO.1 732 CDS 100% 5.625 2.813 Y CYP4F12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08896 pDONR223 100% 71.5% 71.3% None 0_1ins447;115C>T n/a
2 ccsbBroad304_08896 pLX_304 0% 71.5% 71.3% V5 0_1ins447;115C>T n/a
3 TRCN0000467927 CCTCCCATATTCTGTTCTGTTGAC pLX_317 28% 71.5% 71.3% V5 0_1ins447;115C>T n/a
4 ccsbBroadEn_08771 pDONR223 100% 63% 61.4% None (many diffs) n/a
5 ccsbBroad304_08771 pLX_304 0% 63% 61.4% V5 (many diffs) n/a
6 TRCN0000481046 ATCCATTACTGGGAGATGTCCCCC pLX_317 25.3% 63% 61.4% V5 (many diffs) n/a
7 ccsbBroadEn_07253 pDONR223 100% 62.3% 60.1% None (many diffs) n/a
8 ccsbBroad304_07253 pLX_304 0% 62.3% 60.1% V5 (many diffs) n/a
9 TRCN0000477423 CCTAGGAGTTGTCCATAAAGAAGC pLX_317 25% 62.3% 60.1% V5 (many diffs) n/a
Download CSV