Transcript: Human XM_011529492.2

PREDICTED: Homo sapiens disco interacting protein 2 homolog A (DIP2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIP2A (23181)
Length:
6000
CDS:
191..5014

Additional Resources:

NCBI RefSeq record:
XM_011529492.2
NBCI Gene record:
DIP2A (23181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122301 CGTGTCAACCACTGGGATATT pLKO.1 3763 CDS 100% 13.200 18.480 N DIP2A n/a
2 TRCN0000116012 GCACGTTATATACCGCTTATT pLKO.1 329 CDS 100% 13.200 18.480 N DIP2A n/a
3 TRCN0000272305 CACCGGGTACTACACCGTTTA pLKO_005 4489 CDS 100% 10.800 15.120 N DIP2A n/a
4 TRCN0000272361 CATCGCTGAGTGTGCCGTATT pLKO_005 4750 CDS 100% 10.800 15.120 N DIP2A n/a
5 TRCN0000116015 CCATAGAAGTGCCATTAACAA pLKO.1 1578 CDS 100% 5.625 7.875 N DIP2A n/a
6 TRCN0000116014 ACGGTCTAAGTTATGGTGTTA pLKO.1 2385 CDS 100% 4.950 6.930 N DIP2A n/a
7 TRCN0000116013 CGTGTTAACAAGCGTCATGAA pLKO.1 1996 CDS 100% 4.950 6.930 N DIP2A n/a
8 TRCN0000284734 GACTGCCTACATTGAGTATAA pLKO_005 1822 CDS 100% 13.200 9.240 N DIP2A n/a
9 TRCN0000258155 TCAGAAGATGAGGGCTCTTTA pLKO_005 713 CDS 100% 13.200 9.240 N Dip2a n/a
10 TRCN0000272360 TGGCGCTCGTGTTTCCGAATA pLKO_005 1494 CDS 100% 10.800 7.560 N DIP2A n/a
11 TRCN0000284729 TTGCACTTTCTTTAGGCTAAA pLKO_005 5337 3UTR 100% 10.800 7.560 N DIP2A n/a
12 TRCN0000116016 CCTGGAGCTAATGTATGTGTT pLKO.1 2468 CDS 100% 4.950 3.465 N DIP2A n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5650 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5650 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488016 GCAACCCTCAGCCCTGAGCAATAA pLX_317 6.4% 97.7% 97.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492097 CTATCCCCCACAGGATAACAGCCA pLX_317 8.7% 97.6% 97.6% V5 (many diffs) n/a
3 ccsbBroadEn_07848 pDONR223 100% 55.1% 54.8% None (many diffs) n/a
4 ccsbBroad304_07848 pLX_304 0% 55.1% 54.8% V5 (many diffs) n/a
5 TRCN0000472190 GGCTTTACTGGAGGTTCTATCATC pLX_317 3.7% 55.1% 54.8% V5 (many diffs) n/a
6 ccsbBroadEn_02730 pDONR223 99.4% 49.6% 49.6% None 283_387del;760_891del;2632_4821del n/a
7 ccsbBroad304_02730 pLX_304 0% 49.6% 49.6% V5 283_387del;760_891del;2632_4821del n/a
8 TRCN0000471290 CATGAGCAAGGCCTAGCCCATTGC pLX_317 13.3% 49.6% 49.6% V5 (not translated due to prior stop codon) 283_387del;760_891del;2632_4821del n/a
9 TRCN0000480527 TTCGGAAGTCTATGAAGTACAAAT pLX_317 10% 47.2% 45% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV