Transcript: Human XM_011532971.3

PREDICTED: Homo sapiens protein kinase C epsilon (PRKCE), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCE (5581)
Length:
5872
CDS:
1139..3064

Additional Resources:

NCBI RefSeq record:
XM_011532971.3
NBCI Gene record:
PRKCE (5581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000845 CCCTTCAAACCACGCATTAAA pLKO.1 2900 CDS 100% 15.000 21.000 N PRKCE n/a
2 TRCN0000000846 CCACAAGTTCGGTATCCACAA pLKO.1 1576 CDS 100% 4.050 5.670 N PRKCE n/a
3 TRCN0000219726 CTGCATGTTCAGGCATATTAT pLKO.1 4630 3UTR 100% 15.000 10.500 N PRKCE n/a
4 TRCN0000219725 ATATGCTGTGAAGGTCTTAAA pLKO.1 2149 CDS 100% 13.200 9.240 N PRKCE n/a
5 TRCN0000195163 CATCCTAAGTTCCTAGCATAA pLKO.1 4030 3UTR 100% 10.800 7.560 N PRKCE n/a
6 TRCN0000000844 GCAGAACTCAAGGGCAAAGAT pLKO.1 2123 CDS 100% 5.625 3.938 N PRKCE n/a
7 TRCN0000197016 GCCTGGATGAGTTCAACTTCA pLKO.1 2061 CDS 100% 4.950 3.465 N PRKCE n/a
8 TRCN0000000847 TGTCATAGGAAAGCAGGGATA pLKO.1 1426 CDS 100% 4.050 2.835 N PRKCE n/a
9 TRCN0000195553 CGACCTATTTGAGTCCATCCT pLKO.1 2689 CDS 100% 2.640 1.848 N PRKCE n/a
10 TRCN0000000848 GCCAGAAGGAAGAGTGTATGT pLKO.1 1210 CDS 100% 4.950 2.970 N PRKCE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01283 pDONR223 100% 86% 84.1% None (many diffs) n/a
2 ccsbBroad304_01283 pLX_304 27.1% 86% 84.1% V5 (many diffs) n/a
3 TRCN0000465452 ACTCTCTGTTATTACCTATAAACG pLX_317 16.2% 86% 84.1% V5 (many diffs) n/a
4 TRCN0000488864 CGGTCTTCAACTTCCCTTTTGGCA pLX_317 16.3% 86% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489143 GCAGAAAACAATTTGCACCACATC pLX_317 16.3% 86% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488382 TGAAGTTGTTGTTCGTTGGTGCGC pLX_317 14.9% 86% 84% V5 (many diffs) n/a
7 TRCN0000488914 TCCGATTCCCGCTAGAGTGGAAAG pLX_317 14.9% 86% 84% V5 (many diffs) n/a
8 ccsbBroad304_14790 pLX_304 30.6% 85.6% 56.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14790 pDONR223 64.8% 85.5% 54.3% None (many diffs) n/a
Download CSV