Transcript: Human XM_011534040.3

PREDICTED: Homo sapiens NIMA related kinase 4 (NEK4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK4 (6787)
Length:
2625
CDS:
201..2216

Additional Resources:

NCBI RefSeq record:
XM_011534040.3
NBCI Gene record:
NEK4 (6787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001698 CCACAATCAGTAGCGTAAATA pLKO.1 1279 CDS 100% 15.000 21.000 N NEK4 n/a
2 TRCN0000196265 GCGTAAATATTGACATCTTAC pLKO.1 1291 CDS 100% 10.800 15.120 N NEK4 n/a
3 TRCN0000001699 CCAGCTCTTGTCTCAGTTGAA pLKO.1 362 CDS 100% 4.950 3.960 N NEK4 n/a
4 TRCN0000194937 CATCAAAGGATCGACCATTAT pLKO.1 2020 CDS 100% 13.200 9.240 N NEK4 n/a
5 TRCN0000196243 GCAGAACTGATAAGAACAATG pLKO.1 903 CDS 100% 10.800 7.560 N NEK4 n/a
6 TRCN0000001695 CCTACTACATGAGCCCTGAAT pLKO.1 709 CDS 100% 4.950 3.465 N NEK4 n/a
7 TRCN0000001696 CGGCAAGCAGTATGTCATCAA pLKO.1 284 CDS 100% 4.950 3.465 N NEK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489189 GAAACGACAAGCGCAACCCGACTA pLX_317 16.1% 79.5% 79.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14849 pDONR223 64.5% 77.3% 34.8% None (many diffs) n/a
3 ccsbBroad304_14849 pLX_304 0% 77.3% 34.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000471117 GTAGCGTTGCACTCCATGGACCCG pLX_317 19.8% 77.3% 34.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV