Transcript: Human XM_011536071.1

PREDICTED: Homo sapiens serum/glucocorticoid regulated kinase 1 (SGK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGK1 (6446)
Length:
2981
CDS:
381..1961

Additional Resources:

NCBI RefSeq record:
XM_011536071.1
NBCI Gene record:
SGK1 (6446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271154 GTCTGTACATTGGGTTATAAC pLKO_005 2789 3UTR 100% 13.200 18.480 N Sgk1 n/a
2 TRCN0000040176 GCCTGAGCTTATGAATGCCAA pLKO.1 860 CDS 100% 2.640 3.696 N SGK1 n/a
3 TRCN0000327644 GCCTGAGCTTATGAATGCCAA pLKO_005 860 CDS 100% 2.640 3.696 N SGK1 n/a
4 TRCN0000199130 CCCAACGACCTACGGCACTTT pLKO.1 1800 CDS 100% 1.650 2.310 N SGK1 n/a
5 TRCN0000199502 GCCGAGGCTTTCCTAGGCTTT pLKO.1 1908 CDS 100% 1.350 1.890 N SGK1 n/a
6 TRCN0000196562 GCAATCTTATTGCACACTGTT pLKO.1 2086 3UTR 100% 4.950 3.960 N SGK1 n/a
7 TRCN0000312570 GCAATCTTATTGCACACTGTT pLKO_005 2086 3UTR 100% 4.950 3.960 N SGK1 n/a
8 TRCN0000312571 ATTCACTGAACATCGTTTATA pLKO_005 1306 CDS 100% 15.000 10.500 N SGK1 n/a
9 TRCN0000194957 CTGGAAGCTTAGCAATCTTAT pLKO.1 2075 3UTR 100% 13.200 9.240 N SGK1 n/a
10 TRCN0000312569 CTGGAAGCTTAGCAATCTTAT pLKO_005 2075 3UTR 100% 13.200 9.240 N SGK1 n/a
11 TRCN0000196750 GATGACTTCATGGAGATTAAG pLKO.1 1695 CDS 100% 13.200 9.240 N SGK1 n/a
12 TRCN0000199697 CGTCCAATCCTCATGCTAAAC pLKO.1 928 CDS 100% 10.800 7.560 N SGK1 n/a
13 TRCN0000197034 GTCTTGCAATGACTCGTATTC pLKO.1 2580 3UTR 100% 10.800 7.560 N SGK1 n/a
14 TRCN0000040175 CGGAATGTTCTGTTGAAGAAT pLKO.1 1104 CDS 100% 5.625 3.938 N SGK1 n/a
15 TRCN0000009867 TATGTGTGTTTCCGAATGTTT pLKO.1 1992 3UTR 100% 5.625 3.938 N SGK1 n/a
16 TRCN0000040173 CCTCATCCCATCACACAACTT pLKO.1 2902 3UTR 100% 4.950 3.465 N SGK1 n/a
17 TRCN0000040174 GCTGAAATGTACGACAACATT pLKO.1 1572 CDS 100% 0.563 0.394 N SGK1 n/a
18 TRCN0000009866 GAAATGTACGACAACATTCTG pLKO.1 1575 CDS 100% 0.495 0.347 N SGK1 n/a
19 TRCN0000040177 CATGTCTTCTTCTCCTTAATT pLKO.1 1719 CDS 100% 15.000 9.000 N SGK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01527 pDONR223 100% 80.3% 75.2% None (many diffs) n/a
2 ccsbBroad304_01527 pLX_304 52.3% 80.3% 75.2% V5 (many diffs) n/a
3 TRCN0000467477 GTCCCTAAAGATCAAAATTTACCT pLX_317 37.1% 80.3% 75.2% V5 (many diffs) n/a
4 ccsbBroadEn_14840 pDONR223 0% 80.3% 75.2% None (many diffs) n/a
5 ccsbBroad304_14840 pLX_304 0% 80.3% 75.2% V5 (many diffs) n/a
6 TRCN0000473658 TATATATCTACAATCTCAGAACCC pLX_317 36.7% 80.3% 75% V5 (many diffs) n/a
Download CSV