Transcript: Human XM_011536627.3

PREDICTED: Homo sapiens pleckstrin homology and RhoGEF domain containing G3 (PLEKHG3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHG3 (26030)
Length:
7744
CDS:
367..4542

Additional Resources:

NCBI RefSeq record:
XM_011536627.3
NBCI Gene record:
PLEKHG3 (26030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048678 CGGCTGTTGCTAGACAAGATT pLKO.1 3022 CDS 100% 5.625 7.875 N PLEKHG3 n/a
2 TRCN0000048682 GCGCGTCAAGAACAAGGTCTA pLKO.1 3642 CDS 100% 4.050 5.670 N PLEKHG3 n/a
3 TRCN0000048679 CCAGGAAATTGCCAAGCATTT pLKO.1 1143 CDS 100% 10.800 6.480 N PLEKHG3 n/a
4 TRCN0000048681 GAAGCCATCTTGGAAATGGAT pLKO.1 1648 CDS 100% 3.000 1.800 N PLEKHG3 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5872 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5872 3UTR 100% 5.625 2.813 Y EID2B n/a
7 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2012 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11801 pDONR223 100% 87.5% 87.6% None (many diffs) n/a
2 ccsbBroad304_11801 pLX_304 0% 87.5% 87.6% V5 (many diffs) n/a
3 TRCN0000466985 CATCTGGGATGTCAAGACGTACAA pLX_317 8.5% 87.5% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_11802 pDONR223 100% 54% 53.9% None 1_1917del;3277C>A n/a
5 ccsbBroad304_11802 pLX_304 0% 54% 53.9% V5 1_1917del;3277C>A n/a
6 TRCN0000479569 ACAAACAGCACTAATCACATACCT pLX_317 13.8% 54% 53.9% V5 1_1917del;3277C>A n/a
Download CSV