Transcript: Human XM_011536923.1

PREDICTED: Homo sapiens MIS18 binding protein 1 (MIS18BP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIS18BP1 (55320)
Length:
3262
CDS:
109..2343

Additional Resources:

NCBI RefSeq record:
XM_011536923.1
NBCI Gene record:
MIS18BP1 (55320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017672 CCGTGACATAAGGAAATCAAT pLKO.1 438 CDS 100% 5.625 7.875 N MIS18BP1 n/a
2 TRCN0000017669 GCGATGAACGTGACTTACTTA pLKO.1 1085 CDS 100% 5.625 7.875 N MIS18BP1 n/a
3 TRCN0000017671 GCTAGGTTCTATAAATAGGAA pLKO.1 2079 CDS 100% 3.000 4.200 N MIS18BP1 n/a
4 TRCN0000017668 CGTCAAAGAAACTCTTCAGAA pLKO.1 1458 CDS 100% 4.950 3.960 N MIS18BP1 n/a
5 TRCN0000017670 GCACAACAAACTTAGGACTAT pLKO.1 213 CDS 100% 4.950 3.960 N MIS18BP1 n/a
6 TRCN0000433871 TCATTGCTGCAGCTTACTAAA pLKO_005 2501 3UTR 100% 13.200 9.240 N MIS18BP1 n/a
7 TRCN0000436629 ATCCAAGCCAGAGTAGGATTT pLKO_005 2778 3UTR 100% 10.800 7.560 N MIS18BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08516 pDONR223 100% 65.6% 65.6% None 0_1ins1164;1595G>A n/a
2 ccsbBroad304_08516 pLX_304 0% 65.6% 65.6% V5 0_1ins1164;1595G>A n/a
3 TRCN0000479353 TTCGTCTGATTAGCCACAGTGCCA pLX_317 15.7% 65.6% 65.6% V5 0_1ins1164;1595G>A n/a
Download CSV