Transcript: Human XM_011537296.2

PREDICTED: Homo sapiens papilin, proteoglycan like sulfated glycoprotein (PAPLN), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAPLN (89932)
Length:
3096
CDS:
1..3036

Additional Resources:

NCBI RefSeq record:
XM_011537296.2
NBCI Gene record:
PAPLN (89932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073426 CCAATGTAACCGCTTCTGGTA pLKO.1 2352 CDS 100% 2.640 3.696 N PAPLN n/a
2 TRCN0000426480 AGATCCAACTTCGCATCATAG pLKO_005 2987 CDS 100% 10.800 8.640 N PAPLN n/a
3 TRCN0000420886 GCAGGCACCTTTGACGCTAAT pLKO_005 577 CDS 100% 10.800 7.560 N PAPLN n/a
4 TRCN0000073424 CCCAAACAAGTGTGAACTGAA pLKO.1 357 CDS 100% 4.950 3.465 N PAPLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12929 pDONR223 100% 12.5% 12.1% None (many diffs) n/a
2 ccsbBroad304_12929 pLX_304 0% 12.5% 12.1% V5 (many diffs) n/a
3 TRCN0000470729 AAAAGCGCGGATTCACTAAACTAC pLX_317 100% 12.5% 12.1% V5 (many diffs) n/a
Download CSV