Transcript: Human XM_011537616.1

PREDICTED: Homo sapiens La ribonucleoprotein 1, translational regulator (LARP1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LARP1 (23367)
Length:
6491
CDS:
16..2982

Additional Resources:

NCBI RefSeq record:
XM_011537616.1
NBCI Gene record:
LARP1 (23367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346243 CAAGAATACCTCGGCAAATTC pLKO_005 2725 CDS 100% 13.200 18.480 N Larp1 n/a
2 TRCN0000152891 GCAAGAATACCTCGGCAAATT pLKO.1 2724 CDS 100% 13.200 18.480 N LARP1 n/a
3 TRCN0000281136 GCAAGAATACCTCGGCAAATT pLKO_005 2724 CDS 100% 13.200 18.480 N LARP1 n/a
4 TRCN0000152624 GCGCCAGATTGAATACTACTT pLKO.1 915 CDS 100% 4.950 6.930 N LARP1 n/a
5 TRCN0000281138 GCGCCAGATTGAATACTACTT pLKO_005 915 CDS 100% 4.950 6.930 N LARP1 n/a
6 TRCN0000155396 CCTAGACACATACCTGCCAAT pLKO.1 523 CDS 100% 4.050 5.670 N LARP1 n/a
7 TRCN0000153684 CAACCTAAAGACACTACCCAA pLKO.1 1299 CDS 100% 2.640 2.112 N LARP1 n/a
8 TRCN0000376353 AGTTTGGCTACCGAAAGTTTG pLKO_005 776 CDS 100% 10.800 7.560 N Larp1 n/a
9 TRCN0000150575 GCTGGACATATTCAAGGATTT pLKO.1 2592 CDS 100% 10.800 7.560 N LARP1 n/a
10 TRCN0000281135 GCTGGACATATTCAAGGATTT pLKO_005 2592 CDS 100% 10.800 7.560 N LARP1 n/a
11 TRCN0000152197 CAACACGTCTACCATAAGTAT pLKO.1 2350 CDS 100% 5.625 3.938 N LARP1 n/a
12 TRCN0000154155 CAAACACAAGTGGGTTCCATT pLKO.1 435 CDS 100% 4.950 3.465 N LARP1 n/a
13 TRCN0000155395 CGCCAAAGAAGGCTACAGATA pLKO.1 2517 CDS 100% 4.950 3.465 N LARP1 n/a
14 TRCN0000150817 GATGTCAACAAGATCCTCATT pLKO.1 1606 CDS 100% 4.950 3.465 N LARP1 n/a
15 TRCN0000155343 GCACTCGAACACACAGACTTT pLKO.1 2952 CDS 100% 4.950 3.465 N LARP1 n/a
16 TRCN0000281139 GCACTCGAACACACAGACTTT pLKO_005 2952 CDS 100% 4.950 3.465 N LARP1 n/a
17 TRCN0000150984 CAAGAAGTCGAGAACTTCAAA pLKO.1 1801 CDS 100% 0.563 0.394 N LARP1 n/a
18 TRCN0000281209 CAAGAAGTCGAGAACTTCAAA pLKO_005 1801 CDS 100% 0.563 0.394 N LARP1 n/a
19 TRCN0000155099 GCTGTTCCTAAACAGCGCAAA pLKO.1 160 CDS 100% 0.405 0.284 N LARP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07871 pDONR223 100% 95.5% 93.1% None (many diffs) n/a
2 ccsbBroad304_07871 pLX_304 0% 95.5% 93.1% V5 (many diffs) n/a
3 TRCN0000479074 AGATGCCACCCACATCGATAAGCA pLX_317 13.3% 95.5% 93.1% V5 (many diffs) n/a
4 ccsbBroadEn_14080 pDONR223 100% 28.6% 28.5% None 1_2115del;2119C>G n/a
5 ccsbBroad304_14080 pLX_304 0% 28.6% 28.5% V5 1_2115del;2119C>G n/a
6 TRCN0000473104 ATTGCCCCCTGCTCGATCTAATCG pLX_317 61.2% 28.6% 28.5% V5 1_2115del;2119C>G n/a
Download CSV