Transcript: Human XM_011537849.2

PREDICTED: Homo sapiens solute carrier family 2 member 13 (SLC2A13), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A13 (114134)
Length:
1708
CDS:
278..1633

Additional Resources:

NCBI RefSeq record:
XM_011537849.2
NBCI Gene record:
SLC2A13 (114134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537849.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042860 CCCAATTTAAGAGGCCGATTA pLKO.1 881 CDS 100% 10.800 15.120 N SLC2A13 n/a
2 TRCN0000042862 CTTCAGTTACAGCCTTCACAA pLKO.1 1377 CDS 100% 4.950 3.465 N SLC2A13 n/a
3 TRCN0000042859 GCCGAGCTTTAATTGTGGGTT pLKO.1 1245 CDS 100% 2.640 1.848 N SLC2A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537849.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13031 pDONR223 100% 73.7% 73.3% None (many diffs) n/a
2 ccsbBroad304_13031 pLX_304 0% 73.7% 73.3% V5 (many diffs) n/a
3 TRCN0000476960 ATACAACTGGAGGGTTGTATTCTC pLX_317 35.7% 73.7% 73.3% V5 (many diffs) n/a
4 ccsbBroadEn_14356 pDONR223 99.2% 65.2% 65.2% None (many diffs) n/a
5 ccsbBroad304_14356 pLX_304 0% 65.2% 65.2% V5 (many diffs) n/a
6 TRCN0000472241 AAACTTCGACTGGCCTCAATTTTT pLX_317 21.9% 65.2% 65.2% V5 (many diffs) n/a
7 ccsbBroadEn_15223 pDONR223 97.6% 65.1% 65.2% None (many diffs) n/a
8 ccsbBroad304_15223 pLX_304 0% 65.1% 65.2% V5 (many diffs) n/a
9 TRCN0000475482 AACTTAGCGGCCGTGTTTGGTCTT pLX_317 19.6% 65.1% 65.2% V5 (many diffs) n/a
Download CSV