Transcript: Human XM_011541061.2

PREDICTED: Homo sapiens microtubule associated serine/threonine kinase 2 (MAST2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAST2 (23139)
Length:
5969
CDS:
302..5911

Additional Resources:

NCBI RefSeq record:
XM_011541061.2
NBCI Gene record:
MAST2 (23139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147970 CAGTATGTCACGCTCCACGA pXPR_003 AGG 1891 34% 17 1.1194 MAST2 MAST2 76938
2 BRDN0001146731 GCACATCACCTACACTACCA pXPR_003 CGG 753 13% 6 0.6567 MAST2 MAST2 76937
3 BRDN0001146449 AGCTGGCTAACGATGTAGCG pXPR_003 GGG 1596 28% 14 0.1999 MAST2 MAST2 76939
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382276 AGAGGATGATACTAGCTATTT pLKO_005 2935 CDS 100% 13.200 18.480 N MAST2 n/a
2 TRCN0000344670 GGCAACCACAGGAGGGTATAT pLKO_005 3372 CDS 100% 13.200 18.480 N MAST2 n/a
3 TRCN0000001736 GCACAAATGGAAGAGCGACTA pLKO.1 1502 CDS 100% 4.050 5.670 N MAST2 n/a
4 TRCN0000344617 GCACAAATGGAAGAGCGACTA pLKO_005 1502 CDS 100% 4.050 5.670 N MAST2 n/a
5 TRCN0000196409 GTCAGGATGATTGTAAGTTAT pLKO.1 576 CDS 100% 13.200 10.560 N MAST2 n/a
6 TRCN0000219731 TGTGGACATGGTGCGTCTATA pLKO.1 2341 CDS 100% 13.200 10.560 N MAST2 n/a
7 TRCN0000194733 CTCAGTAATCCTGACATATTT pLKO.1 518 CDS 100% 15.000 10.500 N MAST2 n/a
8 TRCN0000219732 ACTTGTATGAGGGTCATATTG pLKO.1 2517 CDS 100% 13.200 9.240 N MAST2 n/a
9 TRCN0000225742 ACTTGTATGAGGGTCATATTG pLKO_005 2517 CDS 100% 13.200 9.240 N Mast2 n/a
10 TRCN0000333014 ACTTGTATGAGGGTCATATTG pLKO_005 2517 CDS 100% 13.200 9.240 N MAST2 n/a
11 TRCN0000197248 GAGGACTTCGAGACCATTAAG pLKO.1 2045 CDS 100% 13.200 9.240 N MAST2 n/a
12 TRCN0000001735 CCAGTATCCTTTGACAGTGAA pLKO.1 1433 CDS 100% 4.950 3.465 N MAST2 n/a
13 TRCN0000001733 CCCAGGCACTAACAGCACTTT pLKO.1 5385 CDS 100% 4.950 3.465 N MAST2 n/a
14 TRCN0000344618 CCCAGGCACTAACAGCACTTT pLKO_005 5385 CDS 100% 4.950 3.465 N MAST2 n/a
15 TRCN0000001734 AGACCTGTGTAATATATGCTC pLKO.1 5937 3UTR 100% 2.640 1.848 N MAST2 n/a
16 TRCN0000010650 CGAATGAGAAACCAGTCCCTT pLKO.1 716 CDS 100% 2.640 1.848 N MAST2 n/a
17 TRCN0000199331 CACATCAAGCTCACGGACTTT pLKO.1 2459 CDS 100% 4.950 2.475 Y PRKY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15007 pDONR223 64.5% 45.5% 12.4% None (many diffs) n/a
2 ccsbBroad304_15007 pLX_304 0% 45.5% 12.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467625 TGCTCCAGGTCCCAGGAGATTCCA pLX_317 12.2% 45.5% 12.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488327 AACTGCACTTAACAACCAAGGTCT pLX_317 13.4% 42.3% 39% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV