Construct: ORF TRCN0000488327
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020548.1_s317c1
- DNA Barcode:
- AACTGCACTTAACAACCAAGGTCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAST2 (23139)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488327
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541069.2 | 56.6% | 52% | (many diffs) |
| 2 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541068.1 | 48.3% | 44.5% | (many diffs) |
| 3 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541067.2 | 48.1% | 44.3% | (many diffs) |
| 4 | human | 23139 | MAST2 | microtubule associated seri... | NM_001324321.1 | 48.1% | 44.3% | (many diffs) |
| 5 | human | 23139 | MAST2 | microtubule associated seri... | XM_006710477.3 | 47.7% | 44% | (many diffs) |
| 6 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000755.1 | 47.5% | 43.8% | (many diffs) |
| 7 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000754.1 | 46.9% | 43.2% | (many diffs) |
| 8 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000753.1 | 46.8% | 43.1% | (many diffs) |
| 9 | human | 23139 | MAST2 | microtubule associated seri... | XM_005270656.5 | 46.2% | 42.5% | (many diffs) |
| 10 | human | 23139 | MAST2 | microtubule associated seri... | XM_005270655.3 | 45.9% | 42.3% | (many diffs) |
| 11 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000752.1 | 45.8% | 42.2% | (many diffs) |
| 12 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541065.1 | 45.6% | 42.1% | (many diffs) |
| 13 | human | 23139 | MAST2 | microtubule associated seri... | NM_001319245.1 | 44% | 40.5% | (many diffs) |
| 14 | human | 23139 | MAST2 | microtubule associated seri... | NM_015112.3 | 43.9% | 40.5% | (many diffs) |
| 15 | human | 23139 | MAST2 | microtubule associated seri... | NM_001324320.1 | 43.8% | 40.3% | (many diffs) |
| 16 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541064.2 | 43.5% | 40.1% | (many diffs) |
| 17 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541063.1 | 43.4% | 40% | (many diffs) |
| 18 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541062.2 | 42.4% | 39.1% | (many diffs) |
| 19 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541061.2 | 42.3% | 39% | (many diffs) |
| 20 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541059.2 | 42.2% | 39% | (many diffs) |
| 21 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502836.3 | 42.3% | 40.9% | (many diffs) |
| 22 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502835.3 | 42.1% | 40.7% | (many diffs) |
| 23 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502834.2 | 40.7% | 39.4% | (many diffs) |
| 24 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_017320018.1 | 40.1% | 38.9% | (many diffs) |
| 25 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502840.2 | 38.9% | 37.7% | (many diffs) |
| 26 | mouse | 17776 | Mast2 | microtubule associated seri... | NM_008641.3 | 38.9% | 37.7% | (many diffs) |
| 27 | mouse | 17776 | Mast2 | microtubule associated seri... | NM_001042743.2 | 38.8% | 37.6% | (many diffs) |
| 28 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502833.1 | 38.8% | 37.5% | (many diffs) |
| 29 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502839.1 | 22.1% | 18.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2448
- ORF length:
- 2376
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcggcct cgctcccgga gcctcagtcc cggacgatcc ccagtatcct 121 ttgacagtga aataataatg atgaatcatg tttacaaaga aagattccca aaggctcatg 181 agcgctcaga gagctcagaa gtggcttttg tgatgcagct ggtgaaaaag ctgatgatta 241 tcattgcccg cccagcacgt ctcctggaat gcctggagtt tgaccctgaa gagttctacc 301 accttttaga agcagctgag ggccacgcca aagagggaca agggattaaa tgtgacattc 361 cccgctacat cgttagccag ctgggcctca cccgggatcc cctagaagaa atggcccagt 421 tgagcagctg tgacagtcct gacactccag agacagatga ttctattgag ggccatgggg 481 catctctgcc atctaaaaag acaccctctg aagaggactt cgagaccatt aagctcatca 541 gcaatggcgc ctatggggct gtatttctgg tgcggcacaa gtccacccgg cagcgctttg 601 ccatgaagaa gatcaacaag cagaacctga tcctacggaa ccagatccag caggccttcg 661 tggagcgtga catactgact ttcgctgaga acccctttgt ggtcagcatg ttctgctcct 721 ttgataccaa gcgccacttg tgcatggtga tggagtacgt tgaaggggga gactgtgcca 781 ctctgctgaa gaatattggg gccctgcctg tggacatggt gcgtctatac tttgcggaaa 841 ctgtgctggc cctggagtac ttacacaact atggcatcgt gcaccgtgac ctcaagcctg 901 acaacctcct aattacatcc atggggcaca tcaagctcac ggactttgga ctgtccaaaa 961 tgggcctcat gagtctgaca acgaacttgt atgagggtca tattgaaaag gatgcccggg 1021 aattcctgga caagcaggta tgcgggaccc cagaatacat tgcgcctgag gtgatcctgc 1081 gccagggcta tgggaagcca gtggactggt gggccatggg cattatcctg tatgagttcc 1141 tggtgggctg cgtccctttt tttggagata ctccggagga gctctttggg caggtgatca 1201 gtgatgagat tgtgtggcct gagggtgatg aggcactgcc cccagacgcc caggacctca 1261 cctccaaact gctccaccag aaccctctgg agagacttgg cacaggcagt gcctatgagg 1321 tgaagcagca cccattcttt actggtctgg actggacagg acttctccgc cagaaggctg 1381 aatttattcc tcagttggag tcagaggatg atactagcta ttttgacacc cgctcagagc 1441 gataccacca catggactcg gaggatgagg aagaagtgag tgaggatggc tgccttgaga 1501 tccgccagtt ctcttcctgc tctccaaggt tcaacaaggt gtacagcagc atggagcggc 1561 tctcactgct cgaggagcgc cggacaccac ccccgaccaa gcgcagcctg agtgaggaga 1621 aggaggacca ttcagatggc ctggcagggc tcaaaggccg agaccggagc tgggtgattg 1681 gctcccctga gatattacgg aagcggctgt cggtgtctga gtcgtcccac acagagagtg 1741 actcaagccc tccaatgaca gtgcgacgcc gctgctcagg cctcctggat gcgcctcggt 1801 tcccggaggg ccctgaggag gccagcagca ccctcaggag gcaaccacag gagggtatat 1861 gggtcctgac acccccatct ggagaggggg tatctgggcc tgtcactgaa cactcagggg 1921 agcagcggcc aaagctggat gaggaagctg ttggccggag cagtggttcc agtccagcta 1981 tggagacccg aggccgtggg acctcacagc tggctgaggg agccacagcc aaggccatca 2041 gtgacctggc tgtgcgtagg gcccgccacc ggctgctctc tggggactca acagagaagc 2101 gcactgctcg ccctgtcaac aaagtgatca agtccgccTC AGCCACAGCC CTCTCACTCC 2161 TCATTCCTTC GGAACACCAC ACCTGCTCCC CGTTGGCCAG CCCCATGTCC CCACATTCTC 2221 AGTCGTCCAA CCCATCATCC CGGGACTCTT CTCCAAGAAG TATGGCTTCA CCCTGCGGGC 2281 CATTCGCGTC TACATGGGTG ACTCCGATGT CTACACCGTG CACCATATGG TGTGGCACGT 2341 GGAGGATGGA GGTCCGGCCA GTGAGGCAGG GCTTCGTCAA GGTGACCTCA TCACCCATGT 2401 CAATGGGGAA CCTGTGCATG GCCTGGTGCA CACGGAGGTG GTGGAGCTAG AACCCAGCTT 2461 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2521 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2581 CTTGTGGAAA GGACGAAACT GCACTTAACA ACCAAGGTCT ACGCGTTAAG TCgacaatca 2641 acctctggat tacaaaattt gtgaaagatt