Construct: ORF TRCN0000467625
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018892.1_s317c1
- Derived from:
- ccsbBroadEn_15007
- DNA Barcode:
- TGCTCCAGGTCCCAGGAGATTCCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MAST2 (23139)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467625
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541069.2 | 60.9% | 16.6% | (many diffs) |
| 2 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541068.1 | 52% | 14.2% | (many diffs) |
| 3 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541067.2 | 51.8% | 14.1% | (many diffs) |
| 4 | human | 23139 | MAST2 | microtubule associated seri... | NM_001324321.1 | 51.8% | 14.1% | (many diffs) |
| 5 | human | 23139 | MAST2 | microtubule associated seri... | XM_006710477.3 | 51.4% | 14% | (many diffs) |
| 6 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000755.1 | 51.2% | 14% | (many diffs) |
| 7 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000754.1 | 50.6% | 13.8% | (many diffs) |
| 8 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000753.1 | 50.3% | 13.7% | (many diffs) |
| 9 | human | 23139 | MAST2 | microtubule associated seri... | XM_005270656.5 | 49.7% | 13.6% | (many diffs) |
| 10 | human | 23139 | MAST2 | microtubule associated seri... | XM_005270655.3 | 49.5% | 13.5% | (many diffs) |
| 11 | human | 23139 | MAST2 | microtubule associated seri... | XM_017000752.1 | 49.3% | 13.4% | (many diffs) |
| 12 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541065.1 | 49.2% | 13.4% | (many diffs) |
| 13 | human | 23139 | MAST2 | microtubule associated seri... | NM_001319245.1 | 47.3% | 12.9% | (many diffs) |
| 14 | human | 23139 | MAST2 | microtubule associated seri... | NM_015112.3 | 47.3% | 12.9% | (many diffs) |
| 15 | human | 23139 | MAST2 | microtubule associated seri... | NM_001324320.1 | 47.1% | 12.9% | (many diffs) |
| 16 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541064.2 | 46.8% | 12.8% | (many diffs) |
| 17 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541063.1 | 46.7% | 12.8% | (many diffs) |
| 18 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541062.2 | 45.7% | 12.5% | (many diffs) |
| 19 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541061.2 | 45.5% | 12.4% | (many diffs) |
| 20 | human | 23139 | MAST2 | microtubule associated seri... | XM_011541059.2 | 45.5% | 12.4% | (many diffs) |
| 21 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502836.3 | 45.7% | 13.3% | (many diffs) |
| 22 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502835.3 | 45.5% | 13.3% | (many diffs) |
| 23 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502834.2 | 44% | 12.8% | (many diffs) |
| 24 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_017320018.1 | 43.4% | 12.7% | (many diffs) |
| 25 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502840.2 | 42.1% | 12.3% | (many diffs) |
| 26 | mouse | 17776 | Mast2 | microtubule associated seri... | NM_008641.3 | 42.1% | 12.3% | (many diffs) |
| 27 | mouse | 17776 | Mast2 | microtubule associated seri... | NM_001042743.2 | 41.9% | 12.2% | (many diffs) |
| 28 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502833.1 | 41.9% | 12.2% | (many diffs) |
| 29 | mouse | 17776 | Mast2 | microtubule associated seri... | XM_006502839.1 | 21.1% | 5.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 858
- ORF length:
- 789
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcggcctcgc tcccggagcc tcagtcccgg acgatcccca gtatcctttg 121 acagtgaaat aataatgatg aatcatgttt acaaagaaag attcccaaag gccaccgcac 181 aaatggaaga gcgactagca gagtttattt cctccaacac tccagacagc gtgctgccct 241 tggcagatgg agccctgagc tttattcatc atcaggtgat tgagatggcc cgagactgcc 301 tggataaatc tcggagtggc ctcattacat cacaatactt ctacgaactt caagataatt 361 tggagaaact tttacaagat gctcatgagc gctcagagag ctcagaagtg gcttttgtga 421 tgcagctggt gaaaaagctg atgattatca ttgcccgccc agcacgtctc ctggaatgcc 481 tggagtttga ccctgaagag ttctaccacc ttttagaagc agctgagggc cacgccaaag 541 agggacaagg gattaaatgt gacattcccc gctacatcgt tagccagctg ggcctcaccc 601 gggatcccct agaagaaatg gcccagttga gcagctgtga cagtcctgac actccagaga 661 cagatgattc tattgagggc catggggcat ctctgccatc taaaaagaca ccctctgaag 721 aggacttcga gaccattaag ctcatcagca atggcgctat ggggctgtat ttctggtgcg 781 gcacaagtcc acccggcagc gcttgccatg agagatcaca agcagacttg atctacggac 841 agatcagcag gctttcgtga gcgtgacata ctgacttcgc tgagaacccc ttggtggtca 901 gcatgttctg ctcctttgat accaagcgcc acttgtgcat ggtgatggag tacgttgaag 961 ggggagactg tgccactctg ctgaagaata ttggggccct gcctgtggac atggtgcgtc 1021 tatactttgc ggaaactgtg ctggccctgg agtacttaca caactatggc atcgtgcacc 1081 gtgacctcaa gcctgacaac ctcctaatta catccatggg gcacatcaag ctcacggact 1141 ttggactgtc caaaatgggc ctcatgagtc tgacaacgaa cttgtatgag ggtcatattg 1201 aaaaggatgc ccgggaattc ctggacaagc aggtatgcgg gaccccagaa tacattgcgc 1261 ctgaggtgat cctgcgccag ggctatggga agccagtgga ctggtgggcc atgggcatta 1321 tcctgtatga gttcctggtg ggctgcgtcc ctttttttgg agatactccg gaggagctct 1381 ttgggcaggt gatcagtgat gagattgtgt ggcctgaggg tgatgaggca ctgcccccag 1441 acgcccagga cctcacctcc aaactgctcc accagaaccc tctggagaga cttggcacag 1501 gcagtgccta tgaggtgaag cagcacccat tctttactgg tctggactgg acaggacttc 1561 tccgccagaa ggctgaattt attcctcagt tggagtcaga ggatgatact agctattttg 1621 acacccgctc agagcgatac caccacatgg actcggagga tgaggaagaa gtgagtgagg 1681 atggctgcct tgagatccgc cagttctctt cctgctctcc aaggttcaac aaggtgtaca 1741 gcagcatgga gcggctctca ctgctcgagg agcgccggac accacccccg accaagcgca 1801 gcctgagtga ggagaaggag gaccattcgg atggcctggc agggctcaaa ggccgagacg 1861 gaggctgggt gattggctcc cctgagatta ttacggaagc ggctgtcggt gtctgagtcg 1921 tcccancaca gagagtgact caagccctcc aatgaacatg cgacgccgct gctcaggctt 1981 cctggatgcg cctcggttcc cggagggccn tgaggagccc agcagcaccc ntcaggaggc 2041 aaccacagga gggtatatgg gtcctgacac cccccattct gagagggggt atctgggcct 2101 gtcactgaac actcnagggg agcagcggcc aaagctggat gaggaagctg ttggccggag 2161 cagtggttcc agtccagcta tggagacccg aggccgtggg acctcacagc tggctgaggg 2221 agccacagcc aaggccatca gtgacctggc tgtgcgtagg gcccgccacc ggctgctctc 2281 tggggactca acagagaagc gcactgctcg ccctgtcaac aaagtgatca agtccgccTC 2341 AGCCACAGCC CTCTCACTCC TCATTCCTTC GGAACACCAC ACCTGCTCCC CGTTGGCCAG 2401 CCCCATGTCC CCACATTCTC AGTCGTCCAA CCCATCATCC CGGGACTCTT CTCCAAGAAG 2461 TATGGCTTCA CCCTGCGGGC CATTCGCGTC TACATGGGTG ACTCCGATGT CTACACCGTG 2521 CACCATATGG TGTGGCACGT GGAGGATGGA GGTCCGGCCA GTGAGGCAGG GCTTCGTCAA 2581 GGTGACCTCA TCACCCATGT CAATGGGGAA CCTGTGCATG GCCTGGTGCA CACGGAGGTG 2641 GTGGAGCTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 2701 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 2761 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATGCTCCA GGTCCCAGGA GATTCCAACG 2821 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt