Transcript: Human XM_011542845.2

PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATM (472)
Length:
8588
CDS:
157..8019

Additional Resources:

NCBI RefSeq record:
XM_011542845.2
NBCI Gene record:
ATM (472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196661 GCCATATTCTTTCCGTCTATT pLKO.1 5069 CDS 100% 13.200 18.480 N ATM n/a
2 TRCN0000038657 GCACTGAAAGAGGATCGTAAA pLKO.1 6208 CDS 100% 10.800 15.120 N ATM n/a
3 TRCN0000038658 CGTGTCTTAATGAGACTACAA pLKO.1 7870 CDS 100% 4.950 6.930 N ATM n/a
4 TRCN0000195732 CTGGTGACTATACAGTCATTT pLKO.1 6886 CDS 100% 1.320 1.848 N ATM n/a
5 TRCN0000039949 GCACGCTAGAACCTACCAAAT pLKO.1 1649 CDS 100% 10.800 8.640 N ATM n/a
6 TRCN0000038654 CCTGCCAACATACTTTAAGTA pLKO.1 8085 3UTR 100% 5.625 4.500 N ATM n/a
7 TRCN0000194969 CAAACGAAATCTCAGTGATAT pLKO.1 7821 CDS 100% 13.200 9.240 N ATM n/a
8 TRCN0000039950 CCTGAAACTTTGGATGAAATT pLKO.1 2269 CDS 100% 13.200 9.240 N ATM n/a
9 TRCN0000038656 GCCATAATTCAGGGTAGTTTA pLKO.1 376 CDS 100% 13.200 9.240 N ATM n/a
10 TRCN0000245109 TGGGTGTGATCTTCAGTATAT pLKO_005 8011 CDS 100% 13.200 9.240 N ATM n/a
11 TRCN0000194686 CCTGCGATTGTTAACATCAAA pLKO.1 1257 CDS 100% 5.625 3.938 N ATM n/a
12 TRCN0000039948 CCTTTCATTCAGCCTTTAGAA pLKO.1 8039 3UTR 100% 5.625 3.938 N ATM n/a
13 TRCN0000194861 CCAAGGTCTATGATATGCTTA pLKO.1 2795 CDS 100% 4.950 3.465 N ATM n/a
14 TRCN0000039951 GCCTCCAATTCTTCACAGTAA pLKO.1 633 CDS 100% 4.950 3.465 N ATM n/a
15 TRCN0000010299 TGATGGTCTTAAGGAACATCT pLKO.1 8189 3UTR 100% 4.950 3.465 N ATM n/a
16 TRCN0000196335 GTATTACCTTTCGTGGTATAA pLKO.1 314 CDS 100% 13.200 7.920 N ATM n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8262 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8263 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10689 pDONR223 100% 5% 5% None 1_2736del;3130_7860del n/a
2 ccsbBroad304_10689 pLX_304 97.8% 5% 5% V5 1_2736del;3130_7860del n/a
3 TRCN0000471841 AACTATAAGACCCGGATATGCACT pLX_317 100% 5% 5% V5 1_2736del;3130_7860del n/a
Download CSV