Transcript: Human XM_011543615.1

PREDICTED: Homo sapiens GTF2H2 family member C (GTF2H2C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTF2H2C (728340)
Length:
1695
CDS:
214..1374

Additional Resources:

NCBI RefSeq record:
XM_011543615.1
NBCI Gene record:
GTF2H2C (728340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337240 ACTTGCGATCCATCTAATATT pLKO_005 739 CDS 100% 15.000 7.500 Y GTF2H2C_2 n/a
2 TRCN0000255677 TTGCGATCCATCTAATATTTA pLKO_005 741 CDS 100% 15.000 7.500 Y GTF2H2B n/a
3 TRCN0000255678 CCAAGATTTAAAGCCTAATAG pLKO_005 432 CDS 100% 13.200 6.600 Y GTF2H2B n/a
4 TRCN0000350794 GCTTACATTAGGAGGCTATTT pLKO_005 1062 CDS 100% 13.200 6.600 Y GTF2H2C_2 n/a
5 TRCN0000263115 GGAATGATGCGCCACCTTTAT pLKO_005 379 CDS 100% 13.200 6.600 Y GTF2H2C n/a
6 TRCN0000263116 GGATCACTTAAAGCTACAATA pLKO_005 295 CDS 100% 13.200 6.600 Y GTF2H2C n/a
7 TRCN0000374264 GGATCACTTAAAGCTACAATA pLKO_005 295 CDS 100% 13.200 6.600 Y Gtf2h2 n/a
8 TRCN0000337272 GGCACGGTCTTACCATCATTT pLKO_005 1167 CDS 100% 13.200 6.600 Y GTF2H2C_2 n/a
9 TRCN0000020964 GTCACAGAAATACCTGAAATT pLKO.1 1525 3UTR 100% 13.200 6.600 Y GTF2H2 n/a
10 TRCN0000255675 TACAAGTCGAGAAGTACTAAT pLKO_005 699 CDS 100% 13.200 6.600 Y GTF2H2B n/a
11 TRCN0000255676 TCTTTAGAAGAAGCTTCATTT pLKO_005 1425 3UTR 100% 13.200 6.600 Y GTF2H2B n/a
12 TRCN0000263118 TGTCACAGAAATACCTGAAAT pLKO_005 1524 3UTR 100% 13.200 6.600 Y GTF2H2C n/a
13 TRCN0000431651 ACAAGTCGAGAAGTACTAATC pLKO_005 700 CDS 100% 10.800 5.400 Y GTF2H2 n/a
14 TRCN0000337239 CACTGTACTTGCTCGTGAAAC pLKO_005 837 CDS 100% 10.800 5.400 Y GTF2H2C_2 n/a
15 TRCN0000020967 CCTATTAGTCAGATTGGAATA pLKO.1 511 CDS 100% 10.800 5.400 Y GTF2H2 n/a
16 TRCN0000263117 GACCAAGATTTAAAGCCTAAT pLKO_005 430 CDS 100% 10.800 5.400 Y GTF2H2C n/a
17 TRCN0000263119 GATCTAATCAAGACCCTAAAG pLKO_005 763 CDS 100% 10.800 5.400 Y GTF2H2C n/a
18 TRCN0000337299 GCATGTAGTATACATTGTATG pLKO_005 1367 CDS 100% 10.800 5.400 Y GTF2H2C_2 n/a
19 TRCN0000423846 TGATTCCAGCATGTAGTATAC pLKO_005 1359 CDS 100% 10.800 5.400 Y GTF2H2 n/a
20 TRCN0000020966 CCTGGCTGTATTCATAAGATT pLKO.1 1320 CDS 100% 5.625 2.813 Y GTF2H2 n/a
21 TRCN0000020965 CGCCACCTTTATGTGGTAGTA pLKO.1 388 CDS 100% 4.950 2.475 Y GTF2H2 n/a
22 TRCN0000020968 GCTCACTTATTCGTATGGGAT pLKO.1 953 CDS 100% 2.640 1.320 Y GTF2H2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05740 pDONR223 100% 95.4% 84.5% None 553C>T;1028_1029ins40;1146_1158del n/a
2 ccsbBroad304_05740 pLX_304 0% 95.4% 84.5% V5 553C>T;1028_1029ins40;1146_1158del n/a
3 TRCN0000466876 CCCACCACTCTGTACATCGGTATC pLX_317 32.2% 95.4% 84.5% V5 553C>T;1028_1029ins40;1146_1158del n/a
4 ccsbBroadEn_15438 pDONR223 0% 42.3% 40.4% None (many diffs) n/a
5 ccsbBroad304_15438 pLX_304 0% 42.3% 40.4% V5 (many diffs) n/a
6 TRCN0000474784 ACGTATCGAGCTAAGCGACCTGAC pLX_317 100% 42.3% 40.4% V5 (many diffs) n/a
Download CSV