Transcript: Human XM_011543994.2

PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASK (8573)
Length:
8329
CDS:
99..2843

Additional Resources:

NCBI RefSeq record:
XM_011543994.2
NBCI Gene record:
CASK (8573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149157 GCTGCTATGACCATTAGCTG pXPR_003 GGG 1771 65% 18 0.4706 CASK CASK 77401
2 BRDN0001148068 ACTTCAGACTCACGACGTAG pXPR_003 TGG 1336 49% 14 0.2382 CASK CASK 77403
3 BRDN0001149003 TGTTGCAAGAATTATGCATG pXPR_003 GGG 1558 57% 15 -0.2709 CASK CASK 77404
4 BRDN0001145000 TGAGGAAATTCAATGCAAGG pXPR_003 AGG 918 33% 9 -0.3992 CASK CASK 77402
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195064 CCGAATAGATAGGAGGAGAAA pLKO.1 2986 3UTR 100% 4.950 6.930 N CASK n/a
2 TRCN0000342340 CCGAATAGATAGGAGGAGAAA pLKO_005 2986 3UTR 100% 4.950 6.930 N CASK n/a
3 TRCN0000195029 CGACGATGTATCAACAGAGAA pLKO.1 177 CDS 100% 4.950 6.930 N CASK n/a
4 TRCN0000342339 CGACGATGTATCAACAGAGAA pLKO_005 177 CDS 100% 4.950 6.930 N CASK n/a
5 TRCN0000000690 ATCTGAGCATAACTGGGAGCA pLKO.1 2858 3UTR 100% 2.160 3.024 N CASK n/a
6 TRCN0000195030 CCCTGAAGAGTTACCAGATTT pLKO.1 1088 CDS 100% 13.200 10.560 N CASK n/a
7 TRCN0000199499 GCCACGAGGATGCGATGTATG pLKO.1 2491 CDS 100% 3.600 2.880 N CASK n/a
8 TRCN0000195100 CCACACATTGTAGAGTTATTG pLKO.1 330 CDS 100% 13.200 9.240 N CASK n/a
9 TRCN0000352672 CCACACATTGTAGAGTTATTG pLKO_005 330 CDS 100% 13.200 9.240 N CASK n/a
10 TRCN0000196604 GCTGAAAGGATCACTGTTTAT pLKO.1 900 CDS 100% 13.200 9.240 N CASK n/a
11 TRCN0000196515 GTAGAGTTATTGGAGACATAT pLKO.1 339 CDS 100% 13.200 9.240 N CASK n/a
12 TRCN0000000694 GCAAAGGAACTAAAGCGTATT pLKO.1 1371 CDS 100% 10.800 7.560 N CASK n/a
13 TRCN0000197068 GCGTACCCTATTCCACATACA pLKO.1 2364 CDS 100% 4.950 3.465 N CASK n/a
14 TRCN0000000692 CCCTGAGAATAACGACGCAAA pLKO.1 1355 CDS 100% 4.050 2.835 N CASK n/a
15 TRCN0000352673 CCCTGAGAATAACGACGCAAA pLKO_005 1355 CDS 100% 4.050 2.835 N CASK n/a
16 TRCN0000000691 CCCTGTAAAGAAGCTGGCATT pLKO.1 1956 CDS 100% 4.050 2.835 N CASK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01960 pDONR223 100% 96.5% 95.9% None (many diffs) n/a
2 ccsbBroad304_01960 pLX_304 0% 96.5% 95.9% V5 (many diffs) n/a
3 ccsbBroadEn_14906 pDONR223 60.4% 96.1% 25.6% None (many diffs) n/a
4 ccsbBroad304_14906 pLX_304 0% 96.1% 25.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474787 ATATACCGGGATTACACATCTTGC pLX_317 16.7% 96.1% 25.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV