Transcript: Human XM_011545510.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 15 (MAP3K15), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K15 (389840)
Length:
5372
CDS:
2067..4682

Additional Resources:

NCBI RefSeq record:
XM_011545510.2
NBCI Gene record:
MAP3K15 (389840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021404 CCGCTGTGTTTACATATTTAA pLKO.1 4763 3UTR 100% 15.000 21.000 N MAP3K15 n/a
2 TRCN0000021406 GCACCGCAATATCGTTCAGTA pLKO.1 2855 CDS 100% 4.950 6.930 N MAP3K15 n/a
3 TRCN0000194932 CGAATGTGCCTTGTAGTTAAT pLKO.1 5189 3UTR 100% 13.200 10.560 N MAP3K15 n/a
4 TRCN0000196430 GTTATACACTTTCGGATATTC pLKO.1 4534 CDS 100% 13.200 10.560 N MAP3K15 n/a
5 TRCN0000196634 GATTTCAGGATGCCGTAAATA pLKO.1 4021 CDS 100% 15.000 10.500 N MAP3K15 n/a
6 TRCN0000194862 CCTATCAAAGTTTGATGAAAG pLKO.1 2489 CDS 100% 10.800 7.560 N MAP3K15 n/a
7 TRCN0000021405 CGGCTGAACTTCTGGTTAGAT pLKO.1 2262 CDS 100% 5.625 3.938 N MAP3K15 n/a
8 TRCN0000021408 CCTGCGATCATTAGTTCAGAA pLKO.1 2183 CDS 100% 4.950 3.465 N MAP3K15 n/a
9 TRCN0000032582 ACCAGAATCTTCTGCGGCAAA pLKO.1 4342 CDS 100% 4.050 2.835 N Kif24 n/a
10 TRCN0000195697 CCTCAGAACTGGTATGGTACT pLKO.1 5142 3UTR 100% 4.050 2.835 N MAP3K15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15322 pDONR223 62.5% 86.6% 1% None 1_347del;1967delC n/a
2 ccsbBroad304_15322 pLX_304 0% 86.6% 1% V5 (not translated due to prior stop codon) 1_347del;1967delC n/a
3 TRCN0000469461 TCCCAATGAACGACCGTCGGTTCC pLX_317 15.9% 86.6% 1% V5 (not translated due to prior stop codon) 1_347del;1967delC n/a
Download CSV