Transcript: Human XM_017000962.1

PREDICTED: Homo sapiens integrator complex subunit 7 (INTS7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS7 (25896)
Length:
2279
CDS:
109..1677

Additional Resources:

NCBI RefSeq record:
XM_017000962.1
NBCI Gene record:
INTS7 (25896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422234 AGAGTGCTGTTACCATAATAA pLKO_005 1155 CDS 100% 15.000 10.500 N INTS7 n/a
2 TRCN0000151342 GACTCCTTATGACAGCTTAAA pLKO.1 1011 CDS 100% 13.200 9.240 N INTS7 n/a
3 TRCN0000366286 GATCTTCTGATTTAGTCAAAT pLKO_005 1127 CDS 100% 13.200 9.240 N Ints7 n/a
4 TRCN0000429073 GATCTTCTGATTTAGTCAAAT pLKO_005 1127 CDS 100% 13.200 9.240 N INTS7 n/a
5 TRCN0000428689 GTATCCATTCCCTATTCTTAT pLKO_005 270 CDS 100% 13.200 9.240 N INTS7 n/a
6 TRCN0000150959 GCAGTAAAGAGACTTGCTATT pLKO.1 907 CDS 100% 10.800 7.560 N INTS7 n/a
7 TRCN0000150786 GCATTCCTAAAGTTAGCTGAT pLKO.1 298 CDS 100% 4.050 2.835 N INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15774 pDONR223 0% 53.9% 51.7% None (many diffs) n/a
2 ccsbBroad304_15774 pLX_304 0% 53.9% 51.7% V5 (many diffs) n/a
3 TRCN0000465262 GATGGAACCCTTTCTCTATATGGT pLX_317 9.6% 53.9% 51.7% V5 (many diffs) n/a
4 ccsbBroadEn_07959 pDONR223 99.6% 53.1% 50.9% None (many diffs) n/a
5 ccsbBroad304_07959 pLX_304 0% 53.1% 50.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV