Transcript: Human XM_017001745.1

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C11 (DNAJC11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC11 (55735)
Length:
3146
CDS:
230..1639

Additional Resources:

NCBI RefSeq record:
XM_017001745.1
NBCI Gene record:
DNAJC11 (55735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236062 CTTTGCGCTCAGACGAGTAAC pLKO_005 547 CDS 100% 10.800 15.120 N DNAJC11 n/a
2 TRCN0000236060 GCAGTAGCTTTCCGCAGATTG pLKO_005 411 CDS 100% 10.800 15.120 N DNAJC11 n/a
3 TRCN0000148169 GAACGACTGTTTAACCTTGTT pLKO.1 199 5UTR 100% 4.950 6.930 N DNAJC11 n/a
4 TRCN0000178851 CGAAGGATAATTGAGGCAGAA pLKO.1 1307 CDS 100% 4.050 5.670 N DNAJC11 n/a
5 TRCN0000178850 CCGTCTGATCATCAAACCATA pLKO.1 1171 CDS 100% 4.950 3.960 N DNAJC11 n/a
6 TRCN0000236063 GATCGATACAGATGGATAAAC pLKO_005 1621 CDS 100% 13.200 9.240 N DNAJC11 n/a
7 TRCN0000115447 GCTGGACAATGAAGACTATTA pLKO.1 60 5UTR 100% 13.200 9.240 N Dnajc11 n/a
8 TRCN0000236061 TTTCCTGGGAGTCTACAAATT pLKO_005 1680 3UTR 100% 13.200 9.240 N DNAJC11 n/a
9 TRCN0000437979 GGTCTCAAGCTGTTCCGTAAT pLKO_005 629 CDS 100% 10.800 7.560 N Dnajc11 n/a
10 TRCN0000179308 GCTGAAATTCGAGAGGAGTTT pLKO.1 260 CDS 100% 4.950 3.465 N DNAJC11 n/a
11 TRCN0000183440 GTTTGGAAATTAGTCGTCTTT pLKO.1 2205 3UTR 100% 4.950 3.465 N DNAJC11 n/a
12 TRCN0000236064 CTGGACAATGAAGACTATTAC pLKO_005 61 5UTR 100% 13.200 7.920 N DNAJC11 n/a
13 TRCN0000180192 CCAGCACTGGTATCTGAGTAA pLKO.1 2867 3UTR 100% 4.950 2.970 N DNAJC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08574 pDONR223 100% 83.7% 83.3% None (many diffs) n/a
2 ccsbBroad304_08574 pLX_304 0% 83.7% 83.3% V5 (many diffs) n/a
3 TRCN0000465874 CCACTATTCTCGCAAAACGTTTTC pLX_317 21.8% 83.7% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_12263 pDONR223 100% 74.4% 74.2% None (many diffs) n/a
5 ccsbBroad304_12263 pLX_304 0% 74.4% 74.2% V5 (many diffs) n/a
6 TRCN0000469711 AGCCTTCGTAGATGATTCGTGCTT pLX_317 30.3% 74.4% 74.2% V5 (many diffs) n/a
Download CSV