Transcript: Human XM_017001934.1

PREDICTED: Homo sapiens MIER1 transcriptional regulator (MIER1), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIER1 (57708)
Length:
4562
CDS:
82..1431

Additional Resources:

NCBI RefSeq record:
XM_017001934.1
NBCI Gene record:
MIER1 (57708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331339 ATCCGCCCACGTCGATGTAAA pLKO_005 334 CDS 100% 13.200 18.480 N MIER1 n/a
2 TRCN0000108034 CAGAAATTCCAGTTGGCATTT pLKO.1 461 CDS 100% 10.800 8.640 N MIER1 n/a
3 TRCN0000300137 CAGAAATTCCAGTTGGCATTT pLKO_005 461 CDS 100% 10.800 8.640 N MIER1 n/a
4 TRCN0000108033 GCCTTTATGGTTATGGTAGTA pLKO.1 104 CDS 100% 4.950 3.960 N MIER1 n/a
5 TRCN0000095737 CCCACGTCGATGTAAATATTT pLKO.1 339 CDS 100% 15.000 10.500 N Mier1 n/a
6 TRCN0000303945 CATGCAGATATGGATACTAAT pLKO_005 1204 CDS 100% 13.200 9.240 N MIER1 n/a
7 TRCN0000108030 CCCATGAAGTATTACTGTTAA pLKO.1 3093 3UTR 100% 13.200 9.240 N MIER1 n/a
8 TRCN0000303944 TGGGAAACTCAAGTCCAAATT pLKO_005 1823 3UTR 100% 13.200 9.240 N MIER1 n/a
9 TRCN0000108031 CCAATGATGATCCATCACAAT pLKO.1 284 CDS 100% 4.950 3.465 N MIER1 n/a
10 TRCN0000095734 GCATTCTATTACATGTGGAAA pLKO.1 865 CDS 100% 4.950 3.465 N Mier1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03845 pDONR223 100% 81% 75.8% None (many diffs) n/a
2 ccsbBroad304_03845 pLX_304 0% 81% 75.8% V5 (many diffs) n/a
3 TRCN0000476937 CTTTTGCCGTTTTACCGCAAAGCA pLX_317 40.1% 81% 75.8% V5 (many diffs) n/a
4 ccsbBroadEn_15952 pDONR223 0% 28.9% 28.9% None 0_1ins60;409_1347del n/a
5 ccsbBroad304_15952 pLX_304 0% 28.9% 28.9% V5 0_1ins60;409_1347del n/a
6 TRCN0000480736 TATCGCCCGGGTTTCGGTTGCTCG pLX_317 94.8% 28.9% 28.9% V5 0_1ins60;409_1347del n/a
Download CSV