Transcript: Human XM_017002082.2

PREDICTED: Homo sapiens SHC adaptor protein 1 (SHC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHC1 (6464)
Length:
3252
CDS:
50..1747

Additional Resources:

NCBI RefSeq record:
XM_017002082.2
NBCI Gene record:
SHC1 (6464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040210 CCACGGGAGCTTTGTCAATAA pLKO.1 457 CDS 100% 13.200 18.480 N SHC1 n/a
2 TRCN0000040208 GCCTATGTACTCTACGCCAAA pLKO.1 2508 3UTR 100% 4.050 5.670 N SHC1 n/a
3 TRCN0000332991 GCCTATGTACTCTACGCCAAA pLKO_005 2508 3UTR 100% 4.050 5.670 N SHC1 n/a
4 TRCN0000040212 CCGCTTTGAAAGTGTCAGTCA pLKO.1 1636 CDS 100% 2.640 3.696 N SHC1 n/a
5 TRCN0000310340 CCGCTTTGAAAGTGTCAGTCA pLKO_005 1636 CDS 100% 2.640 3.696 N SHC1 n/a
6 TRCN0000010433 CTACTTGGTTCGGTACATGGG pLKO.1 532 CDS 100% 2.160 3.024 N SHC1 n/a
7 TRCN0000040211 CCTGACCATCAGTACTATAAT pLKO.1 1028 CDS 100% 15.000 10.500 N SHC1 n/a
8 TRCN0000295997 TGACCATCTCTTAGGTCTAAT pLKO_005 2184 3UTR 100% 13.200 9.240 N SHC1 n/a
9 TRCN0000308024 TCAGCTACCACATGGACAATC pLKO_005 1662 CDS 100% 10.800 7.560 N SHC1 n/a
10 TRCN0000088012 GTTGCCAAAGACCCTGTGAAT pLKO.1 824 CDS 100% 4.950 3.465 N Gm5500 n/a
11 TRCN0000010434 TATGCAACCCTTAGAGATTGC pLKO.1 2361 3UTR 100% 4.050 2.835 N SHC1 n/a
12 TRCN0000009868 GAATGAGTCTCTGTCATCGCT pLKO.1 91 CDS 100% 0.750 0.525 N SHC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491918 GCGGCCTCTAACTACATTGATACC pLX_317 21% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_01531 pDONR223 100% 77.9% 77.9% None 1_330del;749_750ins54;1195_1196insCAG n/a
3 ccsbBroad304_01531 pLX_304 0% 77.9% 77.9% V5 1_330del;749_750ins54;1195_1196insCAG n/a
4 TRCN0000465390 ATCGGCAAGCCATCCCTGGATCAC pLX_317 28.1% 77.9% 77.9% V5 1_330del;749_750ins54;1195_1196insCAG n/a
Download CSV