Transcript: Human XM_017002175.1

PREDICTED: Homo sapiens small proline rich protein 2D (SPRR2D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPRR2D (6703)
Length:
709
CDS:
93..311

Additional Resources:

NCBI RefSeq record:
XM_017002175.1
NBCI Gene record:
SPRR2D (6703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255631 CTGTCCAGGTGGAGCTAAGAA pLKO_005 502 3UTR 100% 5.625 3.938 N SPRR2D n/a
2 TRCN0000154823 GTGATGATCTGTGACAGCAAA pLKO.1 450 3UTR 100% 4.950 3.465 N SPRR2D n/a
3 TRCN0000255632 CCCATCACCAAAGTGTCCACA pLKO_005 200 CDS 100% 2.640 1.584 N SPRR2D n/a
4 TRCN0000155726 CAGCAGTGCCAGCAGAAATAT pLKO.1 234 CDS 100% 15.000 7.500 Y SPRR2A n/a
5 TRCN0000255630 AGCAGTGCCAGCAGAAATATC pLKO_005 235 CDS 100% 13.200 6.600 Y SPRR2D n/a
6 TRCN0000255629 GTCCACCCAAGAGCAAGTAAC pLKO_005 292 CDS 100% 10.800 5.400 Y SPRR2D n/a
7 TRCN0000157883 CAGGGAGCTTCTTTCTCCTTA pLKO.1 414 3UTR 100% 4.950 2.475 Y SPRR2D n/a
8 TRCN0000154965 GAGCATGAGAGGATAAGGATA pLKO.1 331 3UTR 100% 4.950 2.475 Y SPRR2D n/a
9 TRCN0000243250 GTAACAGCTTCAGGATTCATC pLKO_005 308 CDS 100% 4.950 2.475 Y SPRR2B n/a
10 TRCN0000255628 TAACAGCTTCAGGATTCATCA pLKO_005 309 CDS 100% 4.950 2.475 Y SPRR2D n/a
11 TRCN0000243249 ATATCCTCCTGTGACACCTTC pLKO_005 251 CDS 100% 4.050 2.025 Y SPRR2B n/a
12 TRCN0000154441 GCAGAAATATCCTCCTGTGAC pLKO.1 245 CDS 100% 4.050 2.025 Y SPRR2A n/a
13 TRCN0000156201 CAGTGCCAGCAGAAATATCCT pLKO.1 237 CDS 100% 3.000 1.500 Y SPRR2A n/a
14 TRCN0000152719 CAGAAATATCCTCCTGTGACA pLKO.1 246 CDS 100% 2.640 1.320 Y SPRR2A n/a
15 TRCN0000156140 CAGCAGAAATATCCTCCTGTG pLKO.1 243 CDS 100% 2.250 1.125 Y SPRR2A n/a
16 TRCN0000181195 CCTTTCTGAGGCTGCCATATT pLKO.1 477 3UTR 100% 13.200 6.600 Y SPRR2E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06991 pDONR223 100% 97.6% 95.8% None (many diffs) n/a
2 ccsbBroad304_06991 pLX_304 0% 97.6% 95.8% V5 (many diffs) n/a
3 TRCN0000467715 TCCTGGGTCCGAGCTCTAAATTCC pLX_317 100% 97.6% 95.8% V5 (many diffs) n/a
Download CSV