Transcript: Human XM_017003117.1

PREDICTED: Homo sapiens leucine rich pentatricopeptide repeat containing (LRPPRC), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRPPRC (10128)
Length:
5007
CDS:
119..4150

Additional Resources:

NCBI RefSeq record:
XM_017003117.1
NBCI Gene record:
LRPPRC (10128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295840 CACCTTATGGACCGTGATTTA pLKO_005 935 CDS 100% 13.200 18.480 N LRPPRC n/a
2 TRCN0000040199 GCCTCATCATAACGCAAGTTA pLKO.1 3366 CDS 100% 5.625 7.875 N LRPPRC n/a
3 TRCN0000040198 CCGTGAACTTTCTAACGCATA pLKO.1 4533 3UTR 100% 4.050 5.670 N LRPPRC n/a
4 TRCN0000040200 CCTCGCATTATTGAATGCATA pLKO.1 850 CDS 100% 0.495 0.693 N LRPPRC n/a
5 TRCN0000380218 ACGCAAGTTAGGCGGGATTAT pLKO_005 3377 CDS 100% 13.200 10.560 N LRPPRC n/a
6 TRCN0000040201 CGCAGCTTTAAGAGGTGAAAT pLKO.1 2425 CDS 100% 13.200 9.240 N LRPPRC n/a
7 TRCN0000288680 CGCAGCTTTAAGAGGTGAAAT pLKO_005 2425 CDS 100% 13.200 9.240 N LRPPRC n/a
8 TRCN0000010373 GACCATAACTCTGTGCACTTG pLKO.1 4290 3UTR 100% 4.050 2.835 N LRPPRC n/a
9 TRCN0000295839 GACCATAACTCTGTGCACTTG pLKO_005 4290 3UTR 100% 4.050 2.835 N LRPPRC n/a
10 TRCN0000010372 GATGTGAGTCACTATAATGCT pLKO.1 521 CDS 100% 3.000 2.100 N LRPPRC n/a
11 TRCN0000295838 GATGTGAGTCACTATAATGCT pLKO_005 521 CDS 100% 3.000 2.100 N LRPPRC n/a
12 TRCN0000040202 CCTCAAAGGAATGCAAGAATT pLKO.1 1423 CDS 100% 0.000 0.000 N LRPPRC n/a
13 TRCN0000288616 CCTCAAAGGAATGCAAGAATT pLKO_005 1423 CDS 100% 0.000 0.000 N LRPPRC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14956 pDONR223 37.2% 94.7% 12.6% None (many diffs) n/a
2 ccsbBroad304_14956 pLX_304 .6% 94.7% 12.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000472202 GATCCTCATTAAATCGTAGATTCG pLX_317 9.9% 94.7% 12.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV