Transcript: Human XM_017003505.1

PREDICTED: Homo sapiens adhesion G protein-coupled receptor F3 (ADGRF3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRF3 (165082)
Length:
3630
CDS:
528..3617

Additional Resources:

NCBI RefSeq record:
XM_017003505.1
NBCI Gene record:
ADGRF3 (165082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357103 CAAGTTCACCCTCCGACTTAC pLKO_005 1870 CDS 100% 10.800 15.120 N ADGRF3 n/a
2 TRCN0000011535 GCGGAACAAGATCTCCTATTT pLKO.1 2717 CDS 100% 13.200 9.240 N ADGRF3 n/a
3 TRCN0000011537 CAGACTCACAACAGAGTGTAA pLKO.1 806 CDS 100% 4.950 3.465 N ADGRF3 n/a
4 TRCN0000011536 CCTCATTACATCTTCACCATT pLKO.1 3318 CDS 100% 4.950 3.465 N ADGRF3 n/a
5 TRCN0000011534 GCCCTGAAGAATCTCCTGATT pLKO.1 1962 CDS 100% 4.950 3.465 N ADGRF3 n/a
6 TRCN0000011533 GCTCATTCTTACACCCATCTT pLKO.1 3242 CDS 100% 4.950 3.465 N ADGRF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492264 TTCACCGCCCCCTTGCGGCTGGGG pLX_317 10.5% 89% 86.2% V5 (many diffs) n/a
2 TRCN0000489606 GCAACAGGTGTCCTTTCTATCTGA pLX_317 10% 89% 86.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV