Transcript: Human XM_017004859.2

PREDICTED: Homo sapiens VRK serine/threonine kinase 2 (VRK2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VRK2 (7444)
Length:
6734
CDS:
1262..2434

Additional Resources:

NCBI RefSeq record:
XM_017004859.2
NBCI Gene record:
VRK2 (7444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276685 GTCCCAATGGGAACCACAAAC pLKO_005 1488 CDS 100% 10.800 15.120 N Vrk2 n/a
2 TRCN0000010205 GCACACAATAGGTTAATCGAA pLKO.1 1970 CDS 100% 3.000 4.200 N VRK2 n/a
3 TRCN0000010208 ACCACAAACAGTATCAGGAAA pLKO.1 1500 CDS 100% 4.950 3.960 N VRK2 n/a
4 TRCN0000196878 GCTCATAGTTTAGCATATGAT pLKO.1 1790 CDS 100% 0.000 0.000 N VRK2 n/a
5 TRCN0000196902 GATCTCCATCTTGGTATAAAT pLKO.1 2244 CDS 100% 15.000 10.500 N VRK2 n/a
6 TRCN0000010207 GTTGGATGTACTGGAATATAT pLKO.1 1357 CDS 100% 15.000 10.500 N VRK2 n/a
7 TRCN0000342337 GTTGGATGTACTGGAATATAT pLKO_005 1357 CDS 100% 15.000 10.500 N VRK2 n/a
8 TRCN0000195058 CTGGAGGATTTGGATTGATAT pLKO.1 390 5UTR 100% 13.200 9.240 N VRK2 n/a
9 TRCN0000342262 CTGGAGGATTTGGATTGATAT pLKO_005 390 5UTR 100% 13.200 9.240 N VRK2 n/a
10 TRCN0000195264 CACCGAAATGTTGTATTCTTA pLKO.1 2483 3UTR 100% 5.625 3.938 N VRK2 n/a
11 TRCN0000197178 GCTCTTCACCGAAATGTTGTA pLKO.1 2477 3UTR 100% 4.950 3.465 N VRK2 n/a
12 TRCN0000010204 GCCAAACTATCAAGCCCTCAA pLKO.1 1816 CDS 100% 4.050 2.835 N VRK2 n/a
13 TRCN0000342338 GCCAAACTATCAAGCCCTCAA pLKO_005 1816 CDS 100% 4.050 2.835 N VRK2 n/a
14 TRCN0000195115 CTTATTTCAGTGTTTCCTTCC pLKO.1 2500 3UTR 100% 2.250 1.575 N VRK2 n/a
15 TRCN0000199398 CAGGCCAGAATGGTACCTTTA pLKO.1 1302 CDS 100% 0.000 0.000 N VRK2 n/a
16 TRCN0000010206 GGGAAGAAGTTACAGATTTAT pLKO.1 1243 5UTR 100% 15.000 9.000 N VRK2 n/a
17 TRCN0000342336 GGGAAGAAGTTACAGATTTAT pLKO_005 1243 5UTR 100% 15.000 9.000 N VRK2 n/a
18 TRCN0000276682 ATAATGGGACAATAGAGTTTA pLKO_005 1536 CDS 100% 13.200 7.920 N Vrk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489903 TCAGATCACACCCTGTTTGCAGGA pLX_317 24% 76.7% 76.7% V5 (not translated due to prior stop codon) 0_1ins354 n/a
2 TRCN0000488806 TGAAGTCGAGCTTAGTCCGTATAA pLX_317 19.7% 76.6% 76.6% V5 (not translated due to prior stop codon) 0_1ins354;1170_1171insTTG n/a
3 ccsbBroadEn_14877 pDONR223 100% 75.6% 25.1% None (many diffs) n/a
4 ccsbBroad304_14877 pLX_304 0% 75.6% 25.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000466532 GTCACTGTGTGTTCAAAAGAATTA pLX_317 23% 75.6% 25.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV