Transcript: Human XM_017005469.2

PREDICTED: Homo sapiens putative aquaporin-7-like protein 3 (LOC100509620), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC100509620 (100509620)
Length:
2268
CDS:
1077..1667

Additional Resources:

NCBI RefSeq record:
XM_017005469.2
NBCI Gene record:
LOC100509620 (100509620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059697 CGTATGAAGACCACGGGATAA pLKO.1 1513 CDS 100% 10.800 5.400 Y AQP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10684 pDONR223 100% 42.5% 33.5% None (many diffs) n/a
2 ccsbBroad304_10684 pLX_304 0% 42.5% 33.5% V5 (many diffs) n/a
3 TRCN0000480437 ATTTCATTATTATATTTCTAGTTA pLX_317 63% 42.5% 33.5% V5 (many diffs) n/a
4 ccsbBroadEn_13660 pDONR223 100% 41% 27.6% None (many diffs) n/a
5 ccsbBroad304_13660 pLX_304 0% 41% 27.6% V5 (many diffs) n/a
6 TRCN0000469925 TGAGAACACATCCGGTCGACACGT pLX_317 100% 41% 27.6% V5 (many diffs) n/a
Download CSV