Transcript: Human XM_017006933.1

PREDICTED: Homo sapiens parathyroid hormone 1 receptor (PTH1R), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTH1R (5745)
Length:
2277
CDS:
353..2134

Additional Resources:

NCBI RefSeq record:
XM_017006933.1
NBCI Gene record:
PTH1R (5745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003305 CTTCATCAATATCGTCCGGGT pLKO.1 1483 CDS 100% 0.540 0.756 N PTH1R n/a
2 TRCN0000003303 TGTCGCAATCATATACTGTTT pLKO.1 1714 CDS 100% 4.950 3.960 N PTH1R n/a
3 TRCN0000378155 TACAGCGAGTGTGTCAAATTT pLKO_005 851 CDS 100% 15.000 10.500 N PTH1R n/a
4 TRCN0000378220 TTGACCGCCTGGGCATGATTT pLKO_005 903 CDS 100% 13.200 9.240 N PTH1R n/a
5 TRCN0000010775 GATGGGTGGTTGAATGATTTC pLKO.1 2189 3UTR 100% 10.800 7.560 N PTH1R n/a
6 TRCN0000003302 CAACTACTACTGGATTCTGGT pLKO.1 1234 CDS 100% 2.640 1.848 N PTH1R n/a
7 TRCN0000003304 CCTGGGCATGATTTACACCGT pLKO.1 910 CDS 100% 0.660 0.462 N PTH1R n/a
8 TRCN0000378174 GTACCGGAAGCTGCTCAAATC pLKO_005 1558 CDS 100% 0.000 0.000 N PTH1R n/a
9 TRCN0000356169 ACTTCATCCTCTTCATCAATA pLKO_005 1473 CDS 100% 13.200 7.920 N PTH1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06812 pDONR223 100% 99.9% 100% None 1389T>C n/a
2 ccsbBroad304_06812 pLX_304 0% 99.9% 100% V5 1389T>C n/a
3 TRCN0000480580 AGTTTTACACCGCCACACTGTTTC pLX_317 20.4% 99.9% 100% V5 1389T>C n/a
4 TRCN0000489527 AGTACACTGCCAGCCCCGCGCCTG pLX_317 19.5% 99.8% 99.8% V5 1389T>C;1779_1780insG n/a
5 TRCN0000488371 GCAGTTCCGCTTAGCTTTACGGGG pLX_317 19.6% 99.9% 100% V5 (not translated due to prior stop codon) 1389T>C n/a
6 ccsbBroadEn_15552 pDONR223 0% 99.8% 99.8% None 146A>G;1389T>C n/a
7 ccsbBroad304_15552 pLX_304 0% 99.8% 99.8% V5 146A>G;1389T>C n/a
8 ccsbBroadEn_11070 pDONR223 100% 56.1% 55.6% None 987_1047del;1061_1779del n/a
9 ccsbBroad304_11070 pLX_304 0% 56.1% 55.6% V5 987_1047del;1061_1779del n/a
10 TRCN0000474180 CTCCAAGACGGCAAAGGCGTAGCA pLX_317 48.4% 56.1% 55.6% V5 987_1047del;1061_1779del n/a
Download CSV