Transcript: Human XM_017007040.1

PREDICTED: Homo sapiens myotubularin related protein 14 (MTMR14), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTMR14 (64419)
Length:
2283
CDS:
253..1863

Additional Resources:

NCBI RefSeq record:
XM_017007040.1
NBCI Gene record:
MTMR14 (64419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284873 TTCGATACCTGTCAGTCAAAT pLKO_005 929 CDS 100% 13.200 18.480 N MTMR14 n/a
2 TRCN0000002624 CAAGGAATATAAAGATCGGGA pLKO.1 1086 CDS 100% 0.660 0.924 N MTMR14 n/a
3 TRCN0000284885 AGAAGCCAGCCCATGACATTT pLKO_005 1864 CDS 100% 13.200 9.240 N MTMR14 n/a
4 TRCN0000272864 ACTACTGTTTCAGCGTGATTC pLKO_005 524 CDS 100% 10.800 7.560 N MTMR14 n/a
5 TRCN0000284883 CGGTTTGTCTGCCCAGTAATC pLKO_005 703 CDS 100% 10.800 7.560 N MTMR14 n/a
6 TRCN0000381217 GCCCTTAGCAGAGAATCAAAG pLKO_005 1906 3UTR 100% 10.800 7.560 N MTMR14 n/a
7 TRCN0000381664 TTGGGATCTGGTGCAACAAAC pLKO_005 1146 CDS 100% 10.800 7.560 N MTMR14 n/a
8 TRCN0000002623 CGACTTCACTCTCCTCTCCAT pLKO.1 1041 CDS 100% 2.640 1.848 N MTMR14 n/a
9 TRCN0000002625 GAAGCATATTACCTCCGAGGA pLKO.1 1437 CDS 100% 2.160 1.512 N MTMR14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03948 pDONR223 99.5% 78% 75.7% None (many diffs) n/a
2 ccsbBroad304_03948 pLX_304 0% 78% 75.7% V5 (many diffs) n/a
3 TRCN0000472308 TTCGGCTATACTGTCGTCTGCGCA pLX_317 28.3% 78% 75.7% V5 (many diffs) n/a
4 ccsbBroadEn_03947 pDONR223 100% 72.1% 69.9% None (many diffs) n/a
5 ccsbBroad304_03947 pLX_304 0% 72.1% 69.9% V5 (many diffs) n/a
6 TRCN0000470894 AGCTTAAAGGCTTCACAACATCTT pLX_317 18.5% 72.1% 69.9% V5 (many diffs) n/a
7 ccsbBroadEn_15966 pDONR223 0% 69.8% 69.8% None 1_432del;888_889ins75 n/a
8 ccsbBroad304_15966 pLX_304 0% 69.8% 69.8% V5 1_432del;888_889ins75 n/a
9 TRCN0000467037 CCCGTTGAGCGTCTTGCGCTGGGC pLX_317 23.5% 69.8% 69.8% V5 1_432del;888_889ins75 n/a
Download CSV