Transcript: Human XM_017007457.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 13 (MAP3K13), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K13 (9175)
Length:
3260
CDS:
452..2905

Additional Resources:

NCBI RefSeq record:
XM_017007457.1
NBCI Gene record:
MAP3K13 (9175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381526 AGTATCCTGGGACCTACAAAC pLKO_005 1533 CDS 100% 10.800 15.120 N MAP3K13 n/a
2 TRCN0000194716 CTCGTGACTATACTGGCATTT pLKO.1 2930 3UTR 100% 10.800 15.120 N MAP3K13 n/a
3 TRCN0000007104 CGTCCTATCATCCATCCCAAT pLKO.1 1565 CDS 100% 4.050 5.670 N MAP3K13 n/a
4 TRCN0000007103 GCACCCTAACATCATCGCATT pLKO.1 640 CDS 100% 4.050 5.670 N MAP3K13 n/a
5 TRCN0000218449 CGTGATCTCAAATCACCTAAT pLKO_005 836 CDS 100% 1.080 0.864 N MAP3K13 n/a
6 TRCN0000218572 CAGAGATTCCCATTGACATAT pLKO_005 2682 CDS 100% 13.200 9.240 N MAP3K13 n/a
7 TRCN0000007102 CCTGAAGATCTCGTGACTATA pLKO.1 2921 3UTR 100% 13.200 9.240 N MAP3K13 n/a
8 TRCN0000194715 CCTGATGAGTTAGCTGATAAA pLKO.1 2612 CDS 100% 13.200 9.240 N MAP3K13 n/a
9 TRCN0000257402 GCGGGAGAAGGAGCTCATTAA pLKO_005 1489 CDS 100% 13.200 9.240 N MAP3K13 n/a
10 TRCN0000226452 TCAGGCATGCGCTGGATATTC pLKO_005 1389 CDS 100% 13.200 9.240 N MAP3K13 n/a
11 TRCN0000196257 GCCAGTCATATTCAACCTTTA pLKO.1 2529 CDS 100% 10.800 7.560 N MAP3K13 n/a
12 TRCN0000380130 TGTTGCCAGGCTGACGCTTAT pLKO_005 2171 CDS 100% 10.800 7.560 N MAP3K13 n/a
13 TRCN0000007106 CCAGAACAGTATGGGTCCTTA pLKO.1 2213 CDS 100% 4.950 3.465 N MAP3K13 n/a
14 TRCN0000007105 CCCACAAGAAACTTACTTCAA pLKO.1 1255 CDS 100% 4.950 3.465 N MAP3K13 n/a
15 TRCN0000226453 CAAGAATGGCAGGGATCTATT pLKO_005 3127 3UTR 100% 13.200 7.920 N MAP3K13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488326 AGTCAGCTAACGTAAGTCCACAGC pLX_317 11.8% 84.3% 83.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489794 TGTAGGTGAACCTTGAATTACATG pLX_317 6.6% 84.3% 83.3% V5 (many diffs) n/a
3 ccsbBroadEn_11344 pDONR223 100% 80.2% 80.2% None 1_483del n/a
4 ccsbBroad304_11344 pLX_304 0% 80.2% 80.2% V5 1_483del n/a
5 TRCN0000480578 CCAATCTTAGACGCTTGGCGGGGT pLX_317 21.2% 80.2% 80.2% V5 1_483del n/a
Download CSV