Transcript: Human XM_017007522.2

PREDICTED: Homo sapiens SH3 domain binding protein 5 (SH3BP5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3BP5 (9467)
Length:
3029
CDS:
897..1793

Additional Resources:

NCBI RefSeq record:
XM_017007522.2
NBCI Gene record:
SH3BP5 (9467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139218 CTGGTTGAAGCAACGGTGAAA pLKO.1 364 5UTR 100% 4.950 6.930 N SH3BP5 n/a
2 TRCN0000240726 ATGGAATTATTGCTGACATAA pLKO_005 1753 CDS 100% 13.200 9.240 N Sh3bp5 n/a
3 TRCN0000139619 CCTGTCAGAGTTTGGGATGAT pLKO.1 1487 CDS 100% 4.950 3.465 N SH3BP5 n/a
4 TRCN0000349713 CCTGTCAGAGTTTGGGATGAT pLKO_005 1487 CDS 100% 4.950 3.465 N SH3BP5 n/a
5 TRCN0000140434 GCAACGGTGAAACTGGATGAA pLKO.1 373 5UTR 100% 4.950 3.465 N SH3BP5 n/a
6 TRCN0000319389 GCAACGGTGAAACTGGATGAA pLKO_005 373 5UTR 100% 4.950 3.465 N SH3BP5 n/a
7 TRCN0000122325 CATCAACAAGTCCAAGCCTTA pLKO.1 1037 CDS 100% 4.050 2.835 N SH3BP5 n/a
8 TRCN0000143829 CCTTTGAAGATGACAGCTGTA pLKO.1 1327 CDS 100% 4.050 2.835 N SH3BP5 n/a
9 TRCN0000122354 CGAGTACAAGATGGCCCTGAA pLKO.1 1148 CDS 100% 4.050 2.835 N SH3BP5 n/a
10 TRCN0000140930 CAAAGCTGTGGAAGACTCCAA pLKO.1 411 5UTR 100% 2.640 1.848 N SH3BP5 n/a
11 TRCN0000122535 CCAGCTTTAGTTCAGGACCAA pLKO.1 1390 CDS 100% 2.640 1.848 N SH3BP5 n/a
12 TRCN0000190910 CCATCAACAAGTCCAAGCCTT pLKO.1 1036 CDS 100% 2.640 1.848 N Sh3bp5 n/a
13 TRCN0000139445 CAGGGAGAACTGGAGAAGTTA pLKO.1 271 5UTR 100% 5.625 3.375 N SH3BP5 n/a
14 TRCN0000319397 CAGGGAGAACTGGAGAAGTTA pLKO_005 271 5UTR 100% 5.625 3.375 N SH3BP5 n/a
15 TRCN0000142779 CTGGAGAAGAAACTCAAGAGA pLKO.1 1014 CDS 100% 3.000 1.800 N SH3BP5 n/a
16 TRCN0000319318 CTGGAGAAGAAACTCAAGAGA pLKO_005 1014 CDS 100% 3.000 1.800 N SH3BP5 n/a
17 TRCN0000140073 GCTCTGTTCTGGTTGAAGCAA pLKO.1 356 5UTR 100% 3.000 1.800 N SH3BP5 n/a
18 TRCN0000319317 GCTCTGTTCTGGTTGAAGCAA pLKO_005 356 5UTR 100% 3.000 1.800 N SH3BP5 n/a
19 TRCN0000139952 GATCTCAGATGAGATCCACGA pLKO.1 1181 CDS 100% 0.216 0.130 N SH3BP5 n/a
20 TRCN0000240723 AGGATGACAAGCGGCAGTTTG pLKO_005 859 5UTR 100% 10.800 7.560 N Sh3bp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14020 pDONR223 100% 70.1% 70.1% None 0_1ins381 n/a
2 ccsbBroad304_14020 pLX_304 0% 70.1% 70.1% V5 (not translated due to frame shift) 0_1ins381 n/a
3 TRCN0000465450 CCGAAAGCAACTTGTTGGTTTCAC pLX_317 32.5% 70.1% 70.1% V5 (not translated due to frame shift) 0_1ins381 n/a
4 ccsbBroadEn_14941 pDONR223 0% 70.1% 70.1% None 0_1ins381 n/a
5 ccsbBroad304_14941 pLX_304 0% 70.1% 70.1% V5 0_1ins381 n/a
6 TRCN0000473064 CATTCACGTCCACACCCTGCCGCC pLX_317 27.7% 70.1% 70.1% V5 0_1ins381 n/a
Download CSV