Transcript: Human XM_017008281.1

PREDICTED: Homo sapiens platelet derived growth factor receptor alpha (PDGFRA), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDGFRA (5156)
Length:
3333
CDS:
574..3036

Additional Resources:

NCBI RefSeq record:
XM_017008281.1
NBCI Gene record:
PDGFRA (5156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426196 GCACACGGAGCTATGTTATTT pLKO_005 2759 CDS 100% 15.000 21.000 N PDGFRA n/a
2 TRCN0000419988 CCTCTAGGAATGACGGATTAT pLKO_005 1000 CDS 100% 13.200 18.480 N PDGFRA n/a
3 TRCN0000420441 ATGGAGATTTGGTCAACTATT pLKO_005 2648 CDS 100% 13.200 9.240 N PDGFRA n/a
4 TRCN0000428845 CTTCACTGTAGGGCCCTATAT pLKO_005 1155 CDS 100% 13.200 9.240 N PDGFRA n/a
5 TRCN0000195423 CCAAAGAAAGAGCTGGATATC pLKO.1 2713 CDS 100% 10.800 7.560 N PDGFRA n/a
6 TRCN0000001423 CCAGCCTCATATAAGAAGAAA pLKO.1 2905 CDS 100% 5.625 3.938 N PDGFRA n/a
7 TRCN0000001424 CCAGCTTTCATTACCCTCTAT pLKO.1 681 CDS 100% 4.950 3.465 N PDGFRA n/a
8 TRCN0000001425 CGGTGAAAGACAGTGGAGATT pLKO.1 1454 CDS 100% 4.950 3.465 N PDGFRA n/a
9 TRCN0000001426 CAATGGACTTACCCTGGAGAA pLKO.1 1348 CDS 100% 4.050 2.835 N PDGFRA n/a
10 TRCN0000199733 GCCGTGTGACTTTCGCCAAAG pLKO.1 2069 CDS 100% 2.000 1.400 N PDGFRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472927 CCCTCGTGGCCGGGGGTTCCCTGT pLX_317 13.3% 72.4% 70.1% V5 (many diffs) n/a
2 ccsbBroadEn_14734 pDONR223 0% 72.3% 70.1% None (many diffs) n/a
3 ccsbBroad304_14734 pLX_304 0% 72.3% 70.1% V5 (many diffs) n/a
4 TRCN0000491475 TCTACTAACGTTGCATTAGTGGAT pLX_317 10.3% 72.3% 70.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_11024 pDONR223 100% 25.9% 25.6% None (many diffs) n/a
6 ccsbBroad304_11024 pLX_304 0% 25.9% 25.6% V5 (many diffs) n/a
7 TRCN0000468062 GAATTGTACCGACACCTAGAGGAC pLX_317 58.6% 25.9% 25.6% V5 (many diffs) n/a
8 TRCN0000489486 AGACCGCATTTGGTGACAGGGCCA pLX_317 20.7% 20.9% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV