Transcript: Human XM_017011299.2

PREDICTED: Homo sapiens negative elongation factor complex member E (NELFE), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NELFE (7936)
Length:
1427
CDS:
390..1352

Additional Resources:

NCBI RefSeq record:
XM_017011299.2
NBCI Gene record:
NELFE (7936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074961 CTATGTATATGGAGAAGACAT pLKO.1 1001 CDS 100% 4.950 6.930 N NELFE n/a
2 TRCN0000074959 GTGGTGTCAAACGCTCACTAT pLKO.1 355 5UTR 100% 4.950 6.930 N NELFE n/a
3 TRCN0000306858 GTGGTGTCAAACGCTCACTAT pLKO_005 355 5UTR 100% 4.950 6.930 N NELFE n/a
4 TRCN0000366967 TGGATTCCTTGTGCCTCATAT pLKO_005 1363 3UTR 100% 13.200 10.560 N Nelfe n/a
5 TRCN0000074962 ACCCAGATTGTCTACAGTGAT pLKO.1 1296 CDS 100% 4.950 3.465 N NELFE n/a
6 TRCN0000306857 ACCCAGATTGTCTACAGTGAT pLKO_005 1296 CDS 100% 4.950 3.465 N NELFE n/a
7 TRCN0000074958 CTGGATTCCTTGTGCCTCATA pLKO.1 1362 3UTR 100% 4.950 3.465 N NELFE n/a
8 TRCN0000307260 CTGGATTCCTTGTGCCTCATA pLKO_005 1362 3UTR 100% 4.950 3.465 N NELFE n/a
9 TRCN0000074960 CAAAGTCAACATAGCCCGAAA pLKO.1 1184 CDS 100% 4.050 2.835 N NELFE n/a
10 TRCN0000291033 CAAAGTCAACATAGCCCGAAA pLKO_005 1184 CDS 100% 4.050 2.835 N NELFE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01845 pDONR223 100% 84.2% 84.2% None 0_1ins165;237_238insAGCTTTGTGTCTTCT n/a
2 ccsbBroad304_01845 pLX_304 0% 84.2% 84.2% V5 0_1ins165;237_238insAGCTTTGTGTCTTCT n/a
3 TRCN0000469743 CTCAGGTGTCATGTCGTTATGGGA pLX_317 33.8% 84.2% 84.2% V5 0_1ins165;237_238insAGCTTTGTGTCTTCT n/a
4 ccsbBroadEn_13769 pDONR223 100% 74.1% 74.1% None 0_1ins165;413_538del n/a
5 ccsbBroad304_13769 pLX_304 0% 74.1% 74.1% V5 0_1ins165;413_538del n/a
6 TRCN0000467167 CCGATTGATAACTCAGTGGTCTTG pLX_317 30.8% 74.1% 74.1% V5 0_1ins165;413_538del n/a
Download CSV