Transcript: Human XM_017011479.1

PREDICTED: Homo sapiens large tumor suppressor kinase 1 (LATS1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LATS1 (9113)
Length:
4498
CDS:
391..3372

Additional Resources:

NCBI RefSeq record:
XM_017011479.1
NBCI Gene record:
LATS1 (9113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146897 GTAACACTCCTTACTTGAGG pXPR_003 TGG 720 24% 4 0.1404 LATS1 LATS1 76025
2 BRDN0001147815 CTTGATTAGGAGGATTCATG pXPR_003 GGG 929 31% 4 0.1017 LATS1 LATS1 76026
3 BRDN0001148404 GCAGCCATCTGCTCTCGTCG pXPR_003 AGG 441 15% 3 -0.2239 LATS1 LATS1 76023
4 BRDN0001146581 CCTTCTGCTTTACAAACAGG pXPR_003 GGG 1172 39% 4 -0.4899 LATS1 LATS1 76024
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196268 GAATGGGTAGTTCGTCTATAT pLKO.1 2677 CDS 100% 13.200 18.480 N LATS1 n/a
2 TRCN0000199713 GCGAAGGGAATCTCGTATTCA pLKO.1 2265 CDS 100% 5.625 7.875 N LATS1 n/a
3 TRCN0000196748 GATTACAACTTCACCTATTAC pLKO.1 2217 CDS 100% 13.200 9.240 N LATS1 n/a
4 TRCN0000195739 CACACGATTCTAAGTACTATC pLKO.1 2957 CDS 100% 10.800 7.560 N LATS1 n/a
5 TRCN0000001777 CACGGCAAGATAGCATGGATT pLKO.1 2993 CDS 100% 4.950 3.465 N LATS1 n/a
6 TRCN0000001778 GTCTGCTTCATACATTCCTAA pLKO.1 3580 3UTR 100% 4.950 3.465 N LATS1 n/a
7 TRCN0000001779 CAAGTCAGAAATCCACCCAAA pLKO.1 580 CDS 100% 4.050 2.835 N LATS1 n/a
8 TRCN0000001780 GAGAAATTAAGCCATCGTGTT pLKO.1 4378 3UTR 100% 4.050 2.835 N LATS1 n/a
9 TRCN0000001776 GAAGATAAAGACACTAGGAAT pLKO.1 2508 CDS 100% 4.950 2.970 N LATS1 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3343 CDS 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3343 CDS 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488803 CAAGTTGGGTTCATTTCCAAGGGG pLX_317 8% 86.2% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11336 pDONR223 100% 68.6% 68.1% None (many diffs) n/a
3 ccsbBroad304_11336 pLX_304 0% 68.6% 68.1% V5 (many diffs) n/a
4 TRCN0000470200 GCACGCCCAACACTTTTACGTCTA pLX_317 18.8% 68.6% 68.1% V5 (many diffs) n/a
5 ccsbBroadEn_14930 pDONR223 0% 68.6% 68.1% None (many diffs) n/a
6 ccsbBroad304_14930 pLX_304 0% 68.6% 68.1% V5 (many diffs) n/a
7 TRCN0000472788 ACCGTGTACAGCAGCTCTCGGTAC pLX_317 23% 68.6% 68.1% V5 (many diffs) n/a
8 ccsbBroadEn_11335 pDONR223 100% 12.9% 11.8% None (many diffs) n/a
9 ccsbBroad304_11335 pLX_304 0% 12.9% 11.8% V5 (many diffs) n/a
10 TRCN0000466560 AATTGTCACGAACTTAATCGTTTC pLX_317 86.3% 12.9% 11.8% V5 (many diffs) n/a
Download CSV