Transcript: Human XM_017014354.2

PREDICTED: Homo sapiens prune homolog 2 with BCH domain (PRUNE2), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRUNE2 (158471)
Length:
4351
CDS:
60..1157

Additional Resources:

NCBI RefSeq record:
XM_017014354.2
NBCI Gene record:
PRUNE2 (158471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156077 CCCAATGGATTGCATCCACAT pLKO.1 965 CDS 100% 4.050 5.670 N PRUNE2 n/a
2 TRCN0000154470 GCGCATTGACATGAAGGTCAT pLKO.1 530 CDS 100% 4.050 5.670 N PRUNE2 n/a
3 TRCN0000151765 CCTTCTTAGAAGCACTTCTTT pLKO.1 2668 3UTR 100% 5.625 3.938 N PRUNE2 n/a
4 TRCN0000155484 GCCAACAAAGATTCTGGCCAA pLKO.1 420 CDS 100% 2.160 1.512 N PRUNE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13308 pDONR223 100% 50.2% 50.6% None (many diffs) n/a
2 ccsbBroad304_13308 pLX_304 0% 50.2% 50.6% V5 (many diffs) n/a
3 TRCN0000471170 ATCTCCTTCTAATACTGGGGTTTC pLX_317 77.5% 50.2% 50.6% V5 (many diffs) n/a
Download CSV