Transcript: Human XM_017020405.2

PREDICTED: Homo sapiens G protein-coupled receptor 183 (GPR183), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR183 (1880)
Length:
1992
CDS:
120..1205

Additional Resources:

NCBI RefSeq record:
XM_017020405.2
NBCI Gene record:
GPR183 (1880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356878 ACCGCTTTGCCTACACGAATA pLKO_005 363 CDS 100% 10.800 15.120 N GPR183 n/a
2 TRCN0000356942 TACTAGCCTTGGTCGTCATTG pLKO_005 268 CDS 100% 10.800 15.120 N GPR183 n/a
3 TRCN0000221118 GCCTACACGAATAGCCTACTA pLKO.1 371 CDS 100% 4.950 6.930 N GPR183 n/a
4 TRCN0000221115 CCAAAGACATTCGTTCCAGAT pLKO.1 962 CDS 100% 4.050 5.670 N GPR183 n/a
5 TRCN0000221116 CGTGGGAAACTTACTAGCCTT pLKO.1 257 CDS 100% 2.640 3.696 N GPR183 n/a
6 TRCN0000356944 TTGCAGGACTTCCCTTATAAA pLKO_005 1253 3UTR 100% 15.000 10.500 N GPR183 n/a
7 TRCN0000356941 CAGCACGGCCAGGATAGTAAT pLKO_005 200 CDS 100% 13.200 9.240 N GPR183 n/a
8 TRCN0000219433 GCATGGAGTATCCAAACTTTG pLKO.1 661 CDS 100% 10.800 7.560 N Gpr183 n/a
9 TRCN0000221117 CCTGAGTATTGACCGCTTCAT pLKO.1 491 CDS 100% 4.950 3.465 N GPR183 n/a
10 TRCN0000221114 GCAAACAACATAAAGCACAAT pLKO.1 1376 3UTR 100% 4.950 3.465 N GPR183 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00473 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00473 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479853 CGTACCAGTCTACACCCGTCGTGG pLX_317 37.1% 100% 100% V5 n/a
4 TRCN0000487905 GGGGTTCAGCCTTTAGCCCAACGC pLX_317 29% 99.9% 100% V5 (not translated due to prior stop codon) 222G>T n/a
Download CSV