Transcript: Human XM_017020542.1

PREDICTED: Homo sapiens large tumor suppressor kinase 2 (LATS2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LATS2 (26524)
Length:
5402
CDS:
409..3129

Additional Resources:

NCBI RefSeq record:
XM_017020542.1
NBCI Gene record:
LATS2 (26524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000884 CTACTCGCCATACGCCTTTAA pLKO.1 2196 CDS 100% 13.200 18.480 N LATS2 n/a
2 TRCN0000197058 GCAGATTGTGCGGGTCATTAA pLKO.1 849 CDS 100% 13.200 18.480 N LATS2 n/a
3 TRCN0000195674 CCCAAAGTTCGGACCTTATCA pLKO.1 609 CDS 100% 5.625 7.875 N LATS2 n/a
4 TRCN0000000880 CCGTCGATTACTTCACTTGAA pLKO.1 3677 3UTR 100% 4.950 6.930 N LATS2 n/a
5 TRCN0000199570 GCCATCCAAGTCTTCGGTTCA pLKO.1 492 CDS 100% 4.050 3.240 N LATS2 n/a
6 TRCN0000194755 CACTTGAAATTCTGCTCTTCA pLKO.1 3690 3UTR 100% 4.950 3.465 N LATS2 n/a
7 TRCN0000000882 CCTCTGGGATGATGTGTCTAA pLKO.1 2928 CDS 100% 4.950 3.465 N LATS2 n/a
8 TRCN0000000881 GCCATGAAGACCCTAAGGAAA pLKO.1 2491 CDS 100% 4.950 3.465 N LATS2 n/a
9 TRCN0000000883 CAGGACCAAACAGTGACACTT pLKO.1 524 CDS 100% 4.950 2.970 N LATS2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4904 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491325 AAGCGTCCACGACTTTACTTCTCC pLX_317 8.8% 82.2% 78.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488615 TCCCTGCAGGCGAGTTCCCTAGTC pLX_317 10% 82.2% 78.2% V5 (many diffs) n/a
3 ccsbBroadEn_15036 pDONR223 100% 29.4% 27.8% None (many diffs) n/a
4 ccsbBroad304_15036 pLX_304 0% 29.4% 27.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000467147 ATCACCGGTGCAAGCGATCAAGAT pLX_317 23.3% 29.4% 27.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV