Transcript: Human XM_017021313.1

PREDICTED: Homo sapiens MYC associated factor X (MAX), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAX (4149)
Length:
2002
CDS:
359..652

Additional Resources:

NCBI RefSeq record:
XM_017021313.1
NBCI Gene record:
MAX (4149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231551 CTGAGTGAATTGTACCTATTT pLKO_005 1509 3UTR 100% 13.200 18.480 N MAX n/a
2 TRCN0000039863 CCCGTGTGTATTTCTAAGAAA pLKO.1 1592 3UTR 100% 5.625 7.875 N MAX n/a
3 TRCN0000304477 ACGTAGGGACCACATCAAAGA pLKO_005 186 5UTR 100% 4.950 6.930 N Max n/a
4 TRCN0000010375 ACGTAGAAGCTCTTGGACAAC pLKO.1 795 3UTR 100% 4.050 5.670 N MAX n/a
5 TRCN0000039866 GCAAGATATTGACGACCTCAA pLKO.1 330 5UTR 100% 4.050 5.670 N MAX n/a
6 TRCN0000231550 ACACACACCAGCAAGATATTG pLKO_005 320 5UTR 100% 13.200 9.240 N MAX n/a
7 TRCN0000039864 CCACAGAATATATCCAGTATA pLKO.1 284 5UTR 100% 13.200 9.240 N MAX n/a
8 TRCN0000231549 CCACAGAATATATCCAGTATA pLKO_005 284 5UTR 100% 13.200 9.240 N MAX n/a
9 TRCN0000231548 GACAAACGGGCTCATCATAAT pLKO_005 151 5UTR 100% 13.200 9.240 N MAX n/a
10 TRCN0000039867 GACCACATCAAAGACAGCTTT pLKO.1 193 5UTR 100% 4.950 3.465 N MAX n/a
11 TRCN0000042716 GTTTCAATCTGCGGCTGACAA pLKO.1 135 5UTR 100% 4.950 3.465 N Max n/a
12 TRCN0000374209 TGCCCAACTGCAGACCAACTA pLKO_005 493 CDS 100% 4.950 3.465 N Max n/a
13 TRCN0000010374 CATCATAATGCACTGGAACGA pLKO.1 163 5UTR 100% 2.640 1.848 N MAX n/a
14 TRCN0000039865 GCTCATCATAATGCACTGGAA pLKO.1 160 5UTR 100% 2.640 1.848 N MAX n/a
15 TRCN0000010376 TGTGAATCTGAACTGCTCTAC pLKO.1 1078 3UTR 100% 4.050 2.430 N MAX n/a
16 TRCN0000042715 CCCAAATCCTAGACAAAGCAA pLKO.1 266 5UTR 100% 3.000 4.200 N Max n/a
17 TRCN0000316020 CCCAAATCCTAGACAAAGCAA pLKO_005 266 5UTR 100% 3.000 4.200 N Max n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15495 pDONR223 0% 55% 40.5% None (many diffs) n/a
2 ccsbBroad304_15495 pLX_304 0% 55% 40.5% V5 (many diffs) n/a
3 TRCN0000468720 GTCTTCCACGTTCCTTTAATGCAG pLX_317 73.3% 55% 40.5% V5 (many diffs) n/a
4 ccsbBroadEn_15494 pDONR223 0% 54.7% 39.8% None (many diffs) n/a
5 ccsbBroad304_15494 pLX_304 0% 54.7% 39.8% V5 (many diffs) n/a
6 TRCN0000469052 TCAGTACTAGGAAGGTCTCTACGA pLX_317 74.2% 54.7% 39.8% V5 (many diffs) n/a
7 ccsbBroadEn_00978 pDONR223 100% 52% 38.3% None (many diffs) n/a
8 ccsbBroad304_00978 pLX_304 0% 52% 38.3% V5 (many diffs) n/a
9 TRCN0000467427 CCTTCTTCGGGGACGGAAGTTACA pLX_317 69.4% 52% 38.3% V5 (many diffs) n/a
Download CSV