Transcript: Human XM_017021382.1

PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPM1A (5494)
Length:
8691
CDS:
776..2086

Additional Resources:

NCBI RefSeq record:
XM_017021382.1
NBCI Gene record:
PPM1A (5494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380002 AGGGTAATGGGTTGCGATATG pLKO_005 990 CDS 100% 10.800 15.120 N PPM1A n/a
2 TRCN0000348845 AGACTTATGTAAGCGTGATTT pLKO_005 2280 3UTR 100% 13.200 9.240 N Ppm1a n/a
3 TRCN0000348910 AGAGTAGAAGAAATCATAAAG pLKO_005 1880 CDS 100% 13.200 9.240 N Ppm1a n/a
4 TRCN0000002570 CCTTCGTTGTTTCCATGAGTA pLKO.1 2701 3UTR 100% 4.950 3.465 N PPM1A n/a
5 TRCN0000297347 CCTTCGTTGTTTCCATGAGTA pLKO_005 2701 3UTR 100% 4.950 3.465 N PPM1A n/a
6 TRCN0000080639 CGAGACAACATGAGTGTGATT pLKO.1 1778 CDS 100% 4.950 3.465 N Ppm1a n/a
7 TRCN0000002569 GAGAGTTATGTCAGAGAAGAA pLKO.1 1273 CDS 100% 4.950 3.465 N PPM1A n/a
8 TRCN0000280039 GAGAGTTATGTCAGAGAAGAA pLKO_005 1273 CDS 100% 4.950 3.465 N PPM1A n/a
9 TRCN0000002572 GCCGTTTACAATAGACTGAAT pLKO.1 2015 CDS 100% 4.950 3.465 N PPM1A n/a
10 TRCN0000280046 GCCGTTTACAATAGACTGAAT pLKO_005 2015 CDS 100% 4.950 3.465 N PPM1A n/a
11 TRCN0000002568 GCACCCAAAGTATCGCCAGAA pLKO.1 1817 CDS 100% 4.050 2.835 N PPM1A n/a
12 TRCN0000002571 GTGGTCATTCTTTGCTGTGTA pLKO.1 1093 CDS 100% 4.950 2.970 N PPM1A n/a
13 TRCN0000280109 GTGGTCATTCTTTGCTGTGTA pLKO_005 1093 CDS 100% 4.950 2.970 N PPM1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01254 pDONR223 100% 87.6% 87.6% None 1_162del n/a
2 ccsbBroad304_01254 pLX_304 0% 87.6% 87.6% V5 1_162del n/a
3 TRCN0000491767 AGACTACTTGCGATTAGAGAGTGC pLX_317 32.8% 87.6% 87.6% V5 1_162del n/a
Download CSV