Transcript: Human XM_017022879.1

PREDICTED: Homo sapiens WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WWP2 (11060)
Length:
4694
CDS:
281..2893

Additional Resources:

NCBI RefSeq record:
XM_017022879.1
NBCI Gene record:
WWP2 (11060)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320921 GCGGATGGCAGTCTGGAATAA pLKO_005 3077 3UTR 100% 13.200 18.480 N WWP2 n/a
2 TRCN0000001515 CCCAAGGTGCATAATCGTCAA pLKO.1 365 CDS 100% 4.050 5.670 N WWP2 n/a
3 TRCN0000320847 CCCAAGGTGCATAATCGTCAA pLKO_005 365 CDS 100% 4.050 5.670 N WWP2 n/a
4 TRCN0000320849 CTCACCTACTTTCGCTTTATA pLKO_005 2084 CDS 100% 15.000 10.500 N WWP2 n/a
5 TRCN0000001514 CCTCACCTACTTTCGCTTTAT pLKO.1 2083 CDS 100% 13.200 9.240 N WWP2 n/a
6 TRCN0000320850 TGCGCTACTTTGACGAGAAAG pLKO_005 2490 CDS 100% 10.800 7.560 N WWP2 n/a
7 TRCN0000001513 CGGCACAGAGTCATTTAGATT pLKO.1 507 CDS 100% 5.625 3.938 N WWP2 n/a
8 TRCN0000320919 CGGCACAGAGTCATTTAGATT pLKO_005 507 CDS 100% 5.625 3.938 N WWP2 n/a
9 TRCN0000092100 GCAGCACTTCAGCCAAAGATT pLKO.1 1429 CDS 100% 5.625 3.938 N Wwp2 n/a
10 TRCN0000331835 GCAGCACTTCAGCCAAAGATT pLKO_005 1429 CDS 100% 5.625 3.938 N Wwp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07739 pDONR223 100% 99.8% 100% None 1239G>A;1707T>C;2091A>G n/a
2 ccsbBroad304_07739 pLX_304 0% 99.8% 100% V5 1239G>A;1707T>C;2091A>G n/a
3 TRCN0000480373 GATAAACCGGCTAAGACCGCAGGC pLX_317 18.6% 99.8% 100% V5 1239G>A;1707T>C;2091A>G n/a
4 ccsbBroadEn_02608 pDONR223 100% 38.4% 38.5% None 1005_2610delinsG n/a
5 ccsbBroad304_02608 pLX_304 0% 38.4% 38.5% V5 1005_2610delinsG n/a
6 TRCN0000473110 GCACTGCCGGCGAATTGCCCAAAT pLX_317 39.9% 38.4% 38.5% V5 1005_2610delinsG n/a
Download CSV