Transcript: Human XM_017025339.1

PREDICTED: Homo sapiens glucagon like peptide 2 receptor (GLP2R), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLP2R (9340)
Length:
4631
CDS:
553..2232

Additional Resources:

NCBI RefSeq record:
XM_017025339.1
NBCI Gene record:
GLP2R (9340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368459 TAGAGAACGCCACGGATATTT pLKO_005 1007 CDS 100% 15.000 21.000 N GLP2R n/a
2 TRCN0000357058 CTCTGTGTAACAGTCAATTTC pLKO_005 1615 CDS 100% 13.200 10.560 N GLP2R n/a
3 TRCN0000008796 CGTCGTCTTCTACAACTCTTA pLKO.1 1266 CDS 100% 4.950 3.960 N GLP2R n/a
4 TRCN0000008795 GCTCTGTGTAACAGTCAATTT pLKO.1 1614 CDS 100% 13.200 9.240 N GLP2R n/a
5 TRCN0000008798 CCAGGTTCTCTTGCATTACTT pLKO.1 1359 CDS 100% 5.625 3.938 N GLP2R n/a
6 TRCN0000008797 GCCTCATTCTTCTCCTGGAAA pLKO.1 870 CDS 100% 4.950 3.465 N GLP2R n/a
7 TRCN0000008799 CCTGCCCTTCATACTTACCTT pLKO.1 902 CDS 100% 3.000 2.100 N GLP2R n/a
8 TRCN0000368458 AGGTTCTCTTGCATTACTTTG pLKO_005 1361 CDS 100% 10.800 5.400 Y GLP2R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487890 TAATAAGCGGACCTTATTTAAATC pLX_317 20.9% 98.9% 98.9% V5 (not translated due to prior stop codon) 381_398del n/a
2 TRCN0000488982 GGATGGAGTGCCCCATCCATTGGT pLX_317 17.3% 98.8% 98.7% V5 381_398del;1677_1678insG n/a
3 ccsbBroadEn_07393 pDONR223 100% 98.8% 98.7% None 381_398del;1426G>A;1530T>C n/a
4 ccsbBroad304_07393 pLX_304 0% 98.8% 98.7% V5 381_398del;1426G>A;1530T>C n/a
5 TRCN0000468486 AGTCGGTGAACTTCCGATAGCCGT pLX_317 28% 98.8% 98.7% V5 381_398del;1426G>A;1530T>C n/a
Download CSV