Transcript: Human XM_017027720.1

PREDICTED: Homo sapiens erythrocyte membrane protein band 4.1 like 1 (EPB41L1), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPB41L1 (2036)
Length:
5849
CDS:
276..2390

Additional Resources:

NCBI RefSeq record:
XM_017027720.1
NBCI Gene record:
EPB41L1 (2036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307331 TCGAGAAGCGAATCATCATTA pLKO_005 2215 CDS 100% 13.200 18.480 N EPB41L1 n/a
2 TRCN0000294455 GGTAACCAAAGCTGTCGTATA pLKO_005 2315 CDS 100% 10.800 15.120 N EPB41L1 n/a
3 TRCN0000116473 CCGTTCTCTTTCTCCGATCAT pLKO.1 2084 CDS 100% 4.950 6.930 N EPB41L1 n/a
4 TRCN0000287064 CCGTTCTCTTTCTCCGATCAT pLKO_005 2084 CDS 100% 4.950 6.930 N EPB41L1 n/a
5 TRCN0000116475 CCAGAAGATTGCCAAGAAATA pLKO.1 536 CDS 100% 13.200 9.240 N EPB41L1 n/a
6 TRCN0000287065 CCAGAAGATTGCCAAGAAATA pLKO_005 536 CDS 100% 13.200 9.240 N EPB41L1 n/a
7 TRCN0000116474 CCACGGAAATCCGTTCTCTTT pLKO.1 2074 CDS 100% 4.950 3.465 N EPB41L1 n/a
8 TRCN0000116472 CCCACTTGAATGCAAAGGAAA pLKO.1 2867 3UTR 100% 4.950 3.465 N EPB41L1 n/a
9 TRCN0000286998 CCCACTTGAATGCAAAGGAAA pLKO_005 2867 3UTR 100% 4.950 3.465 N EPB41L1 n/a
10 TRCN0000116476 CCAACCAAGATCAAGGAGCTA pLKO.1 1701 CDS 100% 2.640 1.848 N EPB41L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13853 pDONR223 100% 79.9% .7% None (many diffs) n/a
2 ccsbBroad304_13853 pLX_304 0% 79.9% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473176 TATGTAAATCCTCTGCTGACGAAA pLX_317 1.2% 79.9% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00505 pDONR223 100% 76.3% 76.3% None 1_186del;1628_1629ins411 n/a
5 ccsbBroad304_00505 pLX_304 0% 76.3% 76.3% V5 1_186del;1628_1629ins411 n/a
6 TRCN0000472080 CGCAGGTTGCACAGAATGCTCGGT pLX_317 10.9% 76.3% 76.3% V5 1_186del;1628_1629ins411 n/a
Download CSV