Transcript: Human XM_017028903.1

PREDICTED: Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3G (APOBEC3G), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOBEC3G (60489)
Length:
2114
CDS:
358..1932

Additional Resources:

NCBI RefSeq record:
XM_017028903.1
NBCI Gene record:
APOBEC3G (60489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418047 ATTAGAGTGCATTACTTTGAA pLKO_005 1953 3UTR 100% 5.625 7.875 N APOBEC3G n/a
2 TRCN0000052188 GCCAGGTGTATTCCGAACTTA pLKO.1 524 CDS 100% 5.625 7.875 N APOBEC3G n/a
3 TRCN0000052190 GCCCGCATCTATGATGATCAA pLKO.1 1291 CDS 100% 4.950 6.930 N APOBEC3G n/a
4 TRCN0000052189 CCACATAAACACGGTTTCCTT pLKO.1 1096 CDS 100% 3.000 4.200 N APOBEC3G n/a
5 TRCN0000052191 CCTTGGAATAATCTGCCTAAA pLKO.1 877 CDS 100% 10.800 7.560 N APOBEC3G n/a
6 TRCN0000440501 TGCATCGTGACCAGGAGTATG pLKO_005 596 CDS 100% 10.800 7.560 N APOBEC3G n/a
7 TRCN0000425724 ATTGTGCTCAATACACAGAAA pLKO_005 2012 3UTR 100% 4.950 3.465 N APOBEC3G n/a
8 TRCN0000052192 GCATGAGACTTACCTGTGTTA pLKO.1 1002 CDS 100% 4.950 3.465 N APOBEC3G n/a
9 TRCN0000052127 CCATCCTTTCTCGTCGGAATA pLKO.1 431 CDS 100% 10.800 5.400 Y APOBEC3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03889 pDONR223 100% 72.6% 72.5% None (many diffs) n/a
2 ccsbBroad304_03889 pLX_304 0% 72.6% 72.5% V5 (many diffs) n/a
3 TRCN0000479742 GTTCGGCCGCCCCACCAAATAGGT pLX_317 26.7% 72.6% 72.5% V5 (many diffs) n/a
Download CSV