Transcript: Human XM_017029326.2

PREDICTED: Homo sapiens discs large MAGUK scaffold protein 3 (DLG3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLG3 (1741)
Length:
4464
CDS:
143..1243

Additional Resources:

NCBI RefSeq record:
XM_017029326.2
NBCI Gene record:
DLG3 (1741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219897 TGGCGACAGAAAGTATCTTAT pLKO.1 1710 3UTR 100% 13.200 18.480 N DLG3 n/a
2 TRCN0000140857 CCAATGAAGGACCGAGTCAAT pLKO.1 692 CDS 100% 4.950 6.930 N DLG3 n/a
3 TRCN0000330032 CCAATGAAGGACCGAGTCAAT pLKO_005 692 CDS 100% 4.950 6.930 N DLG3 n/a
4 TRCN0000140913 CCGAGTCAATGATGACCTGAT pLKO.1 703 CDS 100% 4.050 5.670 N DLG3 n/a
5 TRCN0000139121 CGACGTGATAATGAGGTGGAT pLKO.1 776 CDS 100% 2.640 2.112 N DLG3 n/a
6 TRCN0000144685 GACTCACTGGAAGAGATTTAT pLKO.1 1151 CDS 100% 15.000 10.500 N DLG3 n/a
7 TRCN0000330033 GACTCACTGGAAGAGATTTAT pLKO_005 1151 CDS 100% 15.000 10.500 N DLG3 n/a
8 TRCN0000144753 GAGTACTTTACAGCCATTGTA pLKO.1 1124 CDS 100% 5.625 3.938 N DLG3 n/a
9 TRCN0000330107 GAGTACTTTACAGCCATTGTA pLKO_005 1124 CDS 100% 5.625 3.938 N DLG3 n/a
10 TRCN0000139153 CATCATGTGACTGTGCCCATT pLKO.1 1460 3UTR 100% 4.050 2.835 N DLG3 n/a
11 TRCN0000139338 CCAAGTCCATTGAAGCCCTTA pLKO.1 1023 CDS 100% 4.050 2.835 N DLG3 n/a
12 TRCN0000330034 GGCTTGTGAAGTGAGCTAAAT pLKO_005 1611 3UTR 100% 13.200 7.920 N DLG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14616 pDONR223 100% 69.4% 15.4% None (many diffs) n/a
2 ccsbBroad304_14616 pLX_304 0% 69.4% 15.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474898 GCATCTGGCTCATCTTTTACCAAT pLX_317 30.4% 69.4% 15.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00448 pDONR223 100% 38.8% 37.8% None (many diffs) n/a
5 ccsbBroad304_00448 pLX_304 0% 38.8% 37.8% V5 (many diffs) n/a
6 TRCN0000477451 GAAAAATTTTCGGACATAACTCAT pLX_317 19.1% 38.8% 37.8% V5 (many diffs) n/a
Download CSV