Transcript: Human XM_017029426.1

PREDICTED: Homo sapiens ribosomal protein S6 kinase A6 (RPS6KA6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPS6KA6 (27330)
Length:
2635
CDS:
813..2333

Additional Resources:

NCBI RefSeq record:
XM_017029426.1
NBCI Gene record:
RPS6KA6 (27330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314958 CATCGTTGTCTGCTAAATTAC pLKO_005 2410 3UTR 100% 13.200 18.480 N RPS6KA6 n/a
2 TRCN0000196526 GAAGAGATACTGCTGCGTATA pLKO.1 1986 CDS 100% 10.800 15.120 N RPS6KA6 n/a
3 TRCN0000314885 GAAGAGATACTGCTGCGTATA pLKO_005 1986 CDS 100% 10.800 15.120 N RPS6KA6 n/a
4 TRCN0000196438 GAGAGTTACTTGACCGTATTC pLKO.1 1603 CDS 100% 10.800 15.120 N RPS6KA6 n/a
5 TRCN0000314884 GAGAGTTACTTGACCGTATTC pLKO_005 1603 CDS 100% 10.800 15.120 N RPS6KA6 n/a
6 TRCN0000380210 ACCATTCACAGGTCCACAATA pLKO_005 2485 3UTR 100% 13.200 10.560 N RPS6KA6 n/a
7 TRCN0000314887 TTTACCTTGTTACGGATTTAA pLKO_005 1573 CDS 100% 15.000 10.500 N RPS6KA6 n/a
8 TRCN0000002266 CTATGCAATGAAGGTGTTAAA pLKO.1 310 5UTR 100% 13.200 9.240 N RPS6KA6 n/a
9 TRCN0000002263 GCAGTAGTGTTCAAGTGTTTA pLKO.1 2522 3UTR 100% 13.200 9.240 N RPS6KA6 n/a
10 TRCN0000196549 GCTTGTGATATCTGGAGTTTA pLKO.1 1899 CDS 100% 13.200 9.240 N RPS6KA6 n/a
11 TRCN0000002265 TGGTGGAAACTGGGACAATAT pLKO.1 2030 CDS 100% 13.200 9.240 N RPS6KA6 n/a
12 TRCN0000314886 TGGTGGAAACTGGGACAATAT pLKO_005 2030 CDS 100% 13.200 9.240 N RPS6KA6 n/a
13 TRCN0000196585 GTCCACAATATTCATACTATG pLKO.1 2496 3UTR 100% 10.800 7.560 N RPS6KA6 n/a
14 TRCN0000196796 GCAGATTCAATCAGGATATGT pLKO.1 1767 CDS 100% 5.625 3.938 N RPS6KA6 n/a
15 TRCN0000002264 GAGTTGTTAAAGAAATCCCTA pLKO.1 156 5UTR 100% 2.640 1.848 N RPS6KA6 n/a
16 TRCN0000002262 GTATATGAATTGAAGGAGGAT pLKO.1 1368 CDS 100% 2.640 1.848 N RPS6KA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489496 ATTAGTCCATTGAATGAACGATAT pLX_317 17.7% 67.9% 67.9% V5 (not translated due to prior stop codon) 0_1ins717 n/a
2 ccsbBroadEn_15044 pDONR223 74.3% 59.8% 11.8% None (many diffs) n/a
3 ccsbBroad304_15044 pLX_304 0% 59.8% 11.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV